Vmn1r60 (NM_001166732) Mouse Untagged Clone

CAT#: MC215316

Vmn1r60 (untagged) - Mouse vomeronasal 1 receptor 60 (Vmn1r60), (10ug)

  View "NM_001166732" in other vectors (6)

USD 410.00


Availability*
3 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Vmn1r60 (NM_001166732) Mouse Untagged Clone
Symbol Vmn1r60
Synonyms EG636697; Gm7184
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>MC215316 representing NM_001166732
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAATGTTGGCTCTTCAGATCCTTTTGCTTTGCCATGTTGTGGTTGGGACTGTGGGCAACATCCTTC
TGTTTGTCCATAACTTCTCTCCAATCTTGACAGACTCCAGACTGAGGCCCATACAGGTCATTCTAATCAA
CTTGGCTGTGGCCAATGCATTCATGCTCCTTCTGTTTGCATATTCATATGACCTTATTGATATTGTTCCC
AGGAAGCCTCCAACTGACCTCAAATGTAAACTTGCATACTTCTTTCACCTAGTTGCTCGAGGCACAATCA
TGTGCTCCACCTGTGTCCTCAGCACCTACCAGTTTGTCACTCTTGTTCCTGGTACCTGGGCTAGGGTCAT
GTTCAGCGAAATATCCCCCAAGGTTGTGAGCTATTGTTGTTACAGCTGCTGGTTGTTCAGTGTCTTAAAT
AATGCTTACATGCCAATGTATGTCAGTGGTCCACAGAAAACACACAATGACTCTGATTCTAAAGGCAATT
CGATATGCTCCATCTCTGGGGTCAGTGTGGACATGAATGTCTTGCGGTTTTCCCATGACATCATATTCCT
TAATATCATGGCCTGGACCAGTGTCTCCATGGTGATTCACCTAAACAGACACCACCAGAGAATGAACCAC
ATACATAAGGTCAATCAAAACAACAGAGGCCATGCTGAGACCAGAGCAGCCCACACCATCCTGATGCTGG
TGGTCACATTTGTGAGCTTATATATTCTAAATTGTATTAGTATTTTACTTCACTTTTCCTTTGTGGAATT
TCGTCTCTGGATGAGGTATGTCACAAATCTCCTGTCTCTAAGCTTCCCCACCATTTCTCCCTTACTGTTG
ATATTTAGGGATTGTAAGGGTCATTGTTCTGTGCACATCATGTCAGTATGGAAATCCATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001166732
ORF Size 903 bp
Insert Size 903
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001166732.1, NP_001160204
RefSeq Size 903
RefSeq ORF 903
Locus ID 636697
Cytogenetics 7 A1|7

Other Versions

Other products for "Vmn1r60"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones