Zfp953 (NM_001038651) Mouse Untagged Clone

CAT#: MC215286

Zfp953 (untagged) - Mouse zinc finger protein 953 (Zfp953), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Zfp953 (NM_001038651) Mouse Untagged Clone
Symbol Zfp953
Synonyms E130120F12Rik
Vector pCMV6-Entry
Sequence Data
>MC215286 representing NM_001038651
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGATATGCTGTCATTCTGGGATGTCGTAATATATTTCTCTGCAGAAGAGTGGGAATACCTGGGTC
CTGCTCAGTGGAAATTATACAGGGATGTGACATTGGAGAATTACAACAACTTTGTTTTTCTGGATCTTGT
TTCCTCTACGCCATACCTGGTCAGATTTCTGGAGCAAATACAAGAGCCTTCAGATGTGAAGAGTCAAGCA
GACATCTCTATGTACTCAGGGGGAAAATGCTATACGTGCAAAGAATGTGGCAACATCTTTGTGGGGAAAG
AAGTATTTCAAAATCATCTGATAATTCATTTAGGAGGGAAGCCCTACAAGTGTGAAGAATGTGGCAAGTC
CTTCCGTTTTCCATCATTACTTTCTCAACACAAACTAATTCATACAGGAGAAAAACCCTACAAGTGTGAA
ACATGTAATAGGGCCTTCCATGTTCCATCAAAACTTTTTCAACATAAAATAATTCACACAAAAGCAAAAC
TCTACAAGTGTGAAGTATGTGGCAAGGCTTTCAATTATTCATCAAGACTTTTACACCATAGGACAATTCA
TACAGGAGAGAAACCATACAAGTGTGAAGTCTGTGGAAAGGCCTTCCACTCTTCACCATCACTTTATCAA
CACATGGGAATTCATACAGGAGAGAAACCCTGCAAGTGTGATAAATGTGGCAAGGCCTTCCGCTTTCCAT
CATTACTTTTAAAACACAAGATAAGTCATACAAACCAAAAACCCTACAAGTGTAAAATATGTGGAGATTT
CCTCCGCTCTCAATCATCACTTCATGAACACAAGTTAATGCATAAAGGAGAGAAACTCTATAAGTGTGAT
GTATGTGGCAAGGCCTTCGAATATCCATCAAGACTTTCAAAACATAAGAAAATTCATACAAGAGAGAAAC
CATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001038651
ORF Size 915 bp
Insert Size 915
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001038651.3, NP_001033740
RefSeq Size 4641
RefSeq ORF 915
Locus ID 629016
Cytogenetics 13|13 B3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.