Majin (NM_001165919) Mouse Untagged Clone

CAT#: MC215216

1700123I01Rik (untagged) - Mouse RIKEN cDNA 1700123I01 gene (1700123I01Rik), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Majin
• Synonyms: 1700123I01Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC215216 representing NM_001165919
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGTTTAAAACCATTCACCTACCCATTTCCAGAGACAAGGTTCCTTCATGCAGGACCCAATGTGTATA
  AGTTCAAAATCAGATATGGCAACAGTATCAGAGGAGAAGAAATAGAGGATAAGGAAGTCATCGTCCAGGA
  GCTGGAGGATTCTATCCGTGCAGTCTTGGCAAACATGGACAGCCTGCAACCCTTTGTTACAGAACACTTC
  ATTGTATTTCCCTATAAAAGCAAGTGGGAGAGAGTTTCCCACCTGAAGTTTAAACATGGGGAAAGCATCC
  TGACGCCCTACCCGTTTGTTTTTACTTTGTATATAGAGATGAAATGGTTTGCTGAAGACTTGCCTTCCGG
  GAAACCAGCAGATGATATTCCTCTTGAGTTGGTCCTAGCTGAGACGGAAGCAGAAGAAGCCACAATGAGG
  AAATGGAAACGGAAACTCATGGAGGAGCCCAGCTCCCCTAGCAGGCAGGGGCCACACAGGGCCAAGATGG
  AGACTTCTAGTGAAGCTTCCAGCAACAAGAAGCCTCTGAAGGAGAGCAAGAGGAGCACGGACGAAGAAGC
  CCAGCAGGAATATCAGGACACCCCAGCTTCTAATGCCATTGCTGTCAAGGAACAGGATGCTGCGTTGGGG
  CATGGCCTGCAAGGGTTGGTTGTCCCTCCACTGCAACATAGCAGTCCACCACCCCCGAAAGAGCCAGGAG
  CCAGAGGCTTCTTGGGGTTTCTAAGTGCTCTCTTCCCGTTCCGGTACTTCTTCAAGAAGAGCGGTCAGTG
  A
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001165919
• Insert Size: 771 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001165919.1, NP_001159391.1
• RefSeq Size: 1613 bp
• RefSeq ORF: 771 bp
• Locus ID: 622554
• UniProt ID: Q9D992
• Cytogenetics: 19 A
• Gene Summary: Meiosis-specific telomere-associated protein involved in meiotic telomere attachment to the nucleus inner membrane, a crucial step for homologous pairing and synapsis. Component of the MAJIN-TERB1-TERB2 complex, which promotes telomere cap exchange by mediating attachment of telomeric DNA to the inner nuclear membrane and replacement of the protective cap of telomeric chromosomes: in early meiosis, the MAJIN-TERB1-TERB2 complex associates with telomeric DNA and the shelterin/telosome complex. During prophase, the complex matures and promotes release of the shelterin/telosome complex from telomeric DNA. In the complex, MAJIN acts as the anchoring subunit to the nucleus inner membrane. MAJIN shows DNA-binding activity, possibly for the stabilization of telomere attachment on the nucleus inner membrane.[UniProtKB/Swiss-Prot Function]