Noto (NM_001007472) Mouse Untagged Clone

CAT#: MC214794

Noto (untagged) - Mouse notochord homolog (Xenopus laevis) (Noto), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Noto
• Synonyms: Flh; MmNot; Not; tc
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC214794 representing NM_001007472
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCCAGCCCTGCTCCCTCAGGCACTCAGGTCCAGCCCGGGAGCCTGCGCCCCTGTCCGGGAGCTGTTT
  CCCCAGTTGTCCCGCGCCGACTAGCTCGGGGACGCCTGGAGTCATCCTTCTCTGTCGAGGCCATCCTGGC
  GAGACCCAAGACCCGAGAGCTGGCGGCCACCTCTCTGCCGCTCTCTACCTGCACCAGTCTGAACCTCCTC
  GGTGCGGTGTCGCAGTACGGGGTCCTGCCCTGGGTGTGCTCCACAGGGTCTTGGCTGCCTGCCTACCTGA
  GCGTGGGCGTCTACCCGCTGTGCTCCATGTCCTGCGTGCCCGGACTGAATGTCACTCACCACCAGCAGGG
  CCTCAGGCTCACAGGATCAGAGCTACCTTACTGTCTAGGCCCTCTGAAATGGGCACCCACCGTGGACCTT
  CGGGACCACGGGACCGAGAGACACACAAAGAGGGTTCGCACAACGTTTAACTTGCAGCAGCTGCAAGAGT
  TGGAGAAGGTGTTTGCAAAGCAGCACAACCTGGTGGGGAAGGAGAGAGCCCAGCTGGCTGCCAGGCTGCA
  CCTGACGGAGAATCAGGTGAGGATCTGGTTCCAAAATCGCAGGGTGAAGTATCAGAAGCAGCAAAAACTG
  AAATTGCCTTCCTCCTCTGTCATGGAGGAGCCCTCCAGCAGCTCAGATGGCAACATCCAGAGTGAAGATG
  CTGAGTTGGGAATTGGCAGTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001007472
• Insert Size: 723 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001007472.2, NP_001007473.1
• RefSeq Size: 1602 bp
• RefSeq ORF: 723 bp
• Locus ID: 384452
• UniProt ID: Q5TIS6
• Cytogenetics: 6 37.44 cM
• Gene Summary: Transcription factor that controls node morphogenesis (PubMed:15231714, PubMed:17884984, PubMed:18061569, PubMed:22357932). Acts downstream of both FOXA2 and Brachyury (T) during notochord development (PubMed:15231714). Is essential for cilia formation in the posterior notochord (PNC) and for left-right patterning; acts upstream of FOXJ1 and RFX3 in this process and is required for the expression of various components important for axonemal assembly and function (PubMed:17884984). Plays a role in regulating axial versus paraxial cell fate (PubMed:18061569). Activates the transcription of ciliary proteins C11orf97 homolog, FAM183B and SPACA9 in the embryonic ventral node (PubMed:27914912).[UniProtKB/Swiss-Prot Function]