Kcnrg (NM_206974) Mouse Untagged Clone

CAT#: MC214525

Kcnrg (untagged) - Mouse potassium channel regulator (Kcnrg), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Kcnrg
• Synonyms: Clld4; E030012H22Rik; Gm745
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC214525 representing NM_206974
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGTGGTCAGGACCTCGTCACTTTGAATGTGGGAGGGAGGATATTCACAACAAGGCCCTCTACCCTCA
  AGCAGTTCCCTGCCTCTCGCTTGGCAGGCATGTTAGATGGCAGAGACCAAGAGTTCAAGACAGTTGATGG
  CCAGATTTTTGTGGACAGAGATGGTGCTTTATTTAGTTTCATTTTAGATTTTTTGAGAAATCATGAGCTT
  CTGTTACCCTCGGACTTTGCAGACCATCATAGGCTTCAGAGAGAGGCTCTTTTCTATGAACTTGATTCTC
  TTGTTGATCTCTTAAGCCAATTCCTGCTCCAATCAAGATCTGCTGTCATGGAGGTCCATTTCCTAAACCA
  AAATACTCAAGCCTTCTTCAGAGTGTTTGGCTCTTGCAGCAAAACAATCGAGATGCTAAGTGGGAGGATT
  ACAATGTTTGTAGAGCGACCCACAGCACTGACCGGGAACAGGAACTCCCCTCTGGCTTTACCTCCACAAA
  GACCTTCTCACCACGATCTGCTTTTCCACTGTGGCTCCGATGGCGCTGCTGAGAACCAAGCTGGAGTCAG
  GTATTTTGAATGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_206974
• Insert Size: 576 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_206974.1, NP_996857.1
• RefSeq Size: 1832 bp
• RefSeq ORF: 576 bp
• Locus ID: 328424
• UniProt ID: Q2TUM3
• Cytogenetics: 14 D1
• Gene Summary: Inhibits potassium fluxes in cells. May regulate Kv1 family channel proteins by retaining a fraction of channels in endomembranes (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) uses an alternate splice site in the coding region, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.