Xaf1 (NM_001037713) Mouse Untagged Clone

CAT#: MC214508

Xaf1 (untagged) - Mouse XIAP associated factor 1 (Xaf1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Xaf1
• Synonyms: Fbox39
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC214508 representing NM_001037713
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGGCTGACTTCCAAGTGTGCAGGAACTGCAAAAGAAATGTGGCCTCTCTCCACTTCATGCTCCACG
  AGGCCCACTGCCTGCGCTTCATAGTCCTTTGCCCAGAATGTGAAGAGCCCATCCCAGAGTCAAAGATGAA
  AGAGCACATGGAAGTTGTGCACCAGCAGACCAAGGAAAGCCAACAGCACCCTGCCAAGTGCAAGTTCTGT
  GAGCTGGCCGTGCAGCTTAGCAATCTGGATGTCCATGAGTCCCACTGTGGCAGCCGGACAGAGCATTGTC
  CACACTGCAACCAGCCCATCACACTCCAAGTACTGTCTCAGCACAAAGCCATGTGTCTGAGTGCAAAGGG
  CAGGCCTGAGGAAGGGAAGAGAATTGTATCATCTCCTGGAAGAAAAACCCGTTGTGATCTTTGCAAACAA
  ATGATTCCAGAAAATACGTATGCCTCCCATATGAAACAATGTTCCGCCCCAAACACTGTGACACGTATTC
  GGGATGAAAGTATAATAGTCATTCCTTCAACCCTTGCATTTATGGACTCTGGAAATCGAAGATCCACAGT
  GAGTAAAGATGTTCGTCCAAAGACAAAAAATAGAAACAGCTCAACAAAGCGAGAGACAAAAAAACAAAAT
  GGCACTGTGGCTCTGCCTTTGAAGTCTGGGCTCCAGCAGAGGGCTGATCTTCCCACAGGAGACGAGACGG
  CCTATGACACTCTCCAGAACTGTTGTCAGTGCCGAATTTTACTTCCCTTGCCCATTCTAAATGAGCACCA
  GGAGAAGTGCCAGAGGTTAGCTCACCAAAAGAAACTCCAGTGGGGCTGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001037713
• Insert Size: 822 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001037713.3, NP_001032802.2
• RefSeq Size: 2598 bp
• RefSeq ORF: 822 bp
• Locus ID: 327959
• UniProt ID: Q5NBU8
• Cytogenetics: 11 B4
• Gene Summary: Seems to function as a negative regulator of members of the IAP (inhibitor of apoptosis protein) family. Inhibits anti-caspase activity of BIRC4. Induces cleavage and inactivation of BIRC4 independent of caspase activation. Mediates TNF-alpha-induced apoptosis and is involved in apoptosis in trophoblast cells. May inhibit BIRC4 indirectly by activating the mitochondrial apoptosis pathway. After translocation to mitochondria, promotes translocation of BAX to mitochondria and cytochrome c release from mitochondria. Seems to promote the redistribution of BIRC4 from the cytoplasm to the nucleus, probably independent of BIRC4 inactivation which seems to occur in the cytoplasm. The BIRC4-XAF1 complex mediates down-regulation of BIRC5/survivin; the process requires the E3 ligase activity of BIRC4. Seems to be involved in cellular sensitivity to the proapoptotic actions of TRAIL. May be a tumor suppressor by mediating apoptosis resistance of cancer cells (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.