6430550D23Rik (NM_001145352) Mouse Untagged Clone

CAT#: MC214442

6430550D23Rik (untagged) - Mouse RIKEN cDNA 6430550D23 gene (6430550D23Rik), transcript variant 2, (10ug)

USD 402.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name 6430550D23Rik (NM_001145352) Mouse Untagged Clone
Symbol 6430550D23Rik
Synonyms RP23-220D12.11
Vector pCMV6-Entry
Sequence Data
>MC214442 representing NM_001145352
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACTCAGTGAGCGAGCATGGGACAGTGTGGAAGAAGCCATCTGGAGTGACTCCCAATTCCCTCCTGC
ACCATTTTGATTTCCACTGTGTGTCCTGTGCCATGCTGGGGAATTCTGGCTTCAGCAATATCAACCAATT
ATTCTACATGGCTTTCAGGACGAATCAGGCCTCCAACCACAGCTCCGAGGCAGAGATGAGGAGCCAAACA
GCAGGACCCTTCATCTGTCCCAGGAATGCCAGTCACCAGGGTTTCTGGGGGCAGTACTGGTTATTGCAGC
TTGCTGATCTGGTGCCCCAAGTGACACGATTTTGGAAGATGGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001145352
ORF Size 327 bp
Insert Size 327
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001145352.1, NP_001138824
RefSeq Size 1588
RefSeq ORF 327
Locus ID 320095
Cytogenetics 2|2 H1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.