Tigar (NM_177003) Mouse Untagged Clone

CAT#: MC214427

9630033F20Rik (untagged) - Mouse RIKEN cDNA 9630033F20 gene (9630033F20Rik), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tigar
• Synonyms: 9630033F20Rik; AA793651; AI595337; C79710; C85509
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC214427 representing NM_177003
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_177003
• Insert Size: 810 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_177003.5, NP_795977.1
• RefSeq Size: 3653 bp
• RefSeq ORF: 810 bp
• Locus ID: 319801
• UniProt ID: Q8BZA9
• Cytogenetics: 6 F3
• Gene Summary: Fructose-bisphosphatase hydrolyzing fructose-2,6-bisphosphate as well as fructose-1,6-bisphosphate (By similarity). Acts as a negative regulator of glycolysis by lowering intracellular levels of fructose-2,6-bisphosphate in a p53/TP53-dependent manner, resulting in the pentose phosphate pathway (PPP) activation and NADPH production (PubMed:23726973). Contributes to the generation of reduced glutathione to cause a decrease in intracellular reactive oxygen species (ROS) content, correlating with its ability to protect cells from oxidative or metabolic stress-induced cell death (PubMed:23726973). Plays a role in promoting protection against cell death during hypoxia by decreasing mitochondria ROS levels in a HK2-dependent manner through a mechanism that is independent of its fructose-bisphosphatase activity (By similarity). In response to cardiac damage stress, mediates p53-induced inhibition of myocyte mitophagy through ROS levels reduction and the subsequent inactivation of BNIP3 (PubMed:22044588). Reduced mitophagy results in an enhanced apoptotic myocyte cell death, and exacerbates cardiac damage (PubMed:22044588). Plays a role in adult intestinal regeneration; contributes to the growth, proliferation and survival of intestinal crypts following tissue ablation (PubMed:23726973). Plays a neuroprotective role against ischemic brain damage by enhancing PPP flux and preserving mitochondria functions (PubMed:24872551). Protects glioma cells from hypoxia- and ROS-induced cell death by inhibiting glycolysis and activating mitochondrial energy metabolism and oxygen consumption in a TKTL1-dependent and p53/TP53-independent manner. Plays a role in cancer cell survival by promoting DNA repair through activating PPP flux in a CDK5-ATM-dependent signaling pathway during hypoxia and/or genome stress-induced DNA damage responses (By similarity). Involved in intestinal tumor progression (PubMed:23726973).[UniProtKB/Swiss-Prot Function]