Kiss1 (NM_178260) Mouse Untagged Clone
CAT#: MC214349
Kiss1 (untagged) - Mouse KiSS-1 metastasis-suppressor (Kiss1), (10ug)
"NM_178260" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Kiss1 |
Synonyms | kisspeptin; metastatin |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC214349 representing NM_178260
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATCTCAATGGCTTCTTGGCAGCTGCTGCTTCTCCTCTGTGTCGCCACCTATGGGGAGCCGCTGGCAA AAGTGAAGCCTGGATCCACAGGCCAGCAGTCCGGACCCCAGGAACTCGTTAATGCCTGGGAAAAGGAATC GCGGTATGCAGAGAGCAAGCCTGGGTCTGCAGGGCTGCGCGCTCGTAGGTCGTCGCCATGCCCGCCGGTT GAGGGCCCCGCGGGGCGCCAGCGGCCCCTGTGTGCCTCCCGCAGTCGCCTGATCCCTGCGCCCCGCGGAG CGGTGCTGGTGCAGCGGGAGAAGGACCTGTCCACCTACAACTGGAACTCCTTCGGCCTGCGCTACGGCAG GAGGCAGGCGGCGCGGGCAGCACGGGGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_178260 |
Insert Size | 381 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_178260.3, NP_839991.2 |
RefSeq Size | 496 bp |
RefSeq ORF | 381 bp |
Locus ID | 280287 |
UniProt ID | Q6Y4S4 |
Cytogenetics | 1 E4 |
Gene Summary | Metastasis suppressor protein. May regulate events downstream of cell-matrix adhesion, perhaps involving cytoskeletal reorganization. Generates a C-terminally amidated peptide, metastin which functions as the endogenous ligand of the G-protein coupled receptor GPR54. Activation of the receptor inhibits cell proliferation and cell migration, key characteristics of tumor metastasis. The receptor is also essential for normal gonadotropin-released hormone physiology and for puberty. The hypothalamic KiSS1/GPR54 system is a pivotal factor in central regulation of the gonadotropic axis at puberty and in adulthood. Intracerebroventricular administration induces an increase in serum LH and FSH levels in prepubertal male and female as well as in adult animals.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226535 | Kiss1 (tGFP-tagged) - Mouse KiSS-1 metastasis-suppressor (Kiss1), (10ug) |
USD 425.00 |
|
MR226535 | Kiss1 (Myc-DDK-tagged) - Mouse KiSS-1 metastasis-suppressor (Kiss1) |
USD 225.00 |
|
MR226535L3 | Lenti ORF clone of Kiss1 (Myc-DDK-tagged) - Mouse KiSS-1 metastasis-suppressor (Kiss1) |
USD 525.00 |
|
MR226535L4 | Lenti ORF clone of Kiss1 (mGFP-tagged) - Mouse KiSS-1 metastasis-suppressor (Kiss1) |
USD 525.00 |
{0} Product Review(s)
Be the first one to submit a review