Slfn8 (NM_001167743) Mouse Untagged Clone

CAT#: MC214330

Slfn8 (untagged) - Mouse schlafen 8 (Slfn8), transcript variant 2, (10ug)

USD 402.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Slfn8 (NM_001167743) Mouse Untagged Clone
Symbol Slfn8
Synonyms MGC30719
Vector pCMV6-Entry
Sequence Data
>MC214330 representing NM_001167743
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGACACATCCCTCCTTAGCAGTGAAATGGTCGTGCCCAGACTTGACCATCTACGCAGGAGAAGTGA
CTATCGGAGAAGAAGATAGAAATAAAATGGACTCAAAGAAAAGAAAGCTGGAGAAGACAAGAATTACAGA
GGCTGCTTGTGCTCTGTTAAACTCTGGAGGAGGATTAATTGCTATGCAAATGACTAACAAGAGTGAGCAT
CCTGTGGAGATGGGACAGGACTTGGAAAAGTCTTTGAGAGAGCTTATTATGTCCCCTAATATGCAGGCTT
TCTTTGAGACCAAGCAACAAGAGGACCAGTTCTACATTTTTGTTAAATCTTGGAGCTGCAGGCCTGAAGA
TGGTTCTACTAAGCCTCGAATTTGCAGCCTGGGCTCTTCTCTGTACTGTAGATCTATAACTTCTAAGGTT
GCCATGGATTCAAGAGAAGCATTTGAATTTCTGAAAGATAAGAAGGCATGTATCAAATACAGGCCTACTG
ATGACGGAGCTCCACCGGCTAAAATTCCGAGAGCCATGTGTCAGAACAGCCTTGAATCAAATCCAGCTTT
TGAAATTTTCCAAAGTAAGAAACTTGAATATGGCCAATGCTTGCTTTTCTCTGAATCCACATCTATAGAG
TTTAAACAATTCTCTACCAAACACGTCCAAGCATATATGAAAAACATAATTCCAGAATACATCTCCGCAT
TTGCAAACACCCAGGGAGGCTATCTTTTCATTGGAGTGGATGATAAGAGAATCATCTTGGGATGCCCAAA
AGACAACGTTGACCGTGACTCTTTGAAAACTGTGGCGAATGAAACAATATCCAAGGTGCCAGTTTTCCAT
TTTTGTTCATCTAAAGACAAGGACAAGGTGTCTTATGAGACCAGAGTCATAGATGTGTTTCAAGAGGGAA
ATTTGTATGGTTATCTCTGTGTGATCAAAGTAGAGCCGTTCTGCTGTGCAGTGTTCTCAGAGGCTCCCAT
TTCATGGATGGTAGACAAGGAGAAAGGTGTCTACAGACTGAACACTGAGGAATGGGTACGCATGATGGTG
GATTTTGGCCCAGAGGCATCTTCCAAAGATCTATCTAAAGATTTTGAATGTCAGCTGAGTCTATGCAACA
GCCCCCCACACTGCAGACCAGTGTATTCTAAAAAAGGACTGCAGCATAAAGTTGACCTGCAGCAGCGTTT
ATTTCAAGGGCAAAAAGAATCTGCCAGGCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001167743
ORF Size 1224 bp
Insert Size 1224
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001167743.1, NP_001161215
RefSeq Size 3083
RefSeq ORF 1224
Locus ID 276950
Cytogenetics 11|11 C
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.