Fam107a (NM_183187) Mouse Untagged Clone

CAT#: MC214268

Fam107a (untagged) - Mouse family with sequence similarity 107, member A (Fam107a), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fam107a
• Synonyms: DRR1; RP24-111B7.1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC214268 representing NM_183187
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTACTCAGAGATCCAGAGGGAGCGGGCTGACATCGAGGGACTCATGGCCAGACCAGAGTACAGAGAGT
  GGAACTCAGAGCTCATCAAACCCAAGAAGCTGCTGAACCCTGTGAAGGCTTCTCGGAGCCATCAGGAGCT
  GCACCGTGAGCTGCTTATGAACCACAAAAGGGGCTTGGGTATGGACAGCAAGCCTGAGCTGCAGCGAGTT
  CTAGAGCACCGTCGCAGGAATCAGCTGATCAAAAAGAAGGAGGAGGAGCTAGAGGCCAAGCGGATGCAGT
  GCCCCTTCAAGCAGGAGCTGCTGAGGCGGCAGCAGAGACTGAACCAGCTGGAAAACCCACCACAGAGAGA
  CGAGGACCACGCCCCTGAGTTCATCAAAGTCCGGGAAAACCTACGCAGAATCACCACACTGACCAGCGAG
  GAAAGAGCACTGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_183187
• Insert Size: 435 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_183187.3, NP_899010.1
• RefSeq Size: 3144 bp
• RefSeq ORF: 435 bp
• Locus ID: 268709
• UniProt ID: Q78TU8
• Cytogenetics: 14 A1
• Gene Summary: Stress-inducible actin-binding protein that plays a role in synaptic and cognitive functions by modulating actin filamentous (F-actin) dynamics (PubMed:21969592). Mediates polymerization of globular actin to F-actin (PubMed:21969592). Also binds to, stabilizes and bundles F-actin (PubMed:21969592). Involved in synaptic function by regulating neurite outgrowth in an actin-dependent manner and for the acquisition of hippocampus-dependent cognitive function, such as learning and long-term memory (PubMed:21969592). Plays a role in the actin and microtubule cytoskeleton organization; negatively regulates focal adhesion (FA) assembly promoting malignant glial cell migration in an actin-, microtubule- and MAP1A-dependent manner. Also involved in neuroblastoma G1/S phase cell cycle progression and cell proliferation inhibition by stimulating ubiquitination of NF-kappa-B subunit RELA and NF-kappa-B degradation in a COMMD1- and actin-dependent manner. May play a role in tumor development (By similarity).[UniProtKB/Swiss-Prot Function]