Fam19a2 (NM_182807) Mouse Untagged Clone

CAT#: MC214259

Fam19a2 (untagged) - Mouse family with sequence similarity 19, member A2 (Fam19a2), (10ug)

USD 402.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Fam19a2 (NM_182807) Mouse Untagged Clone
Symbol Fam19a2
Synonyms 6330575M02; FAM19A2 TAFA-2; Tafa-2; TAFA2
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC214259 representing NM_182807
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATCACCAAGATGAATAAGAGATACTTGCAGAAAGCAACACAAGGAAAGCTTCTGATAATTATTTTTA
TAGTGACCTTGTGGGGGAAAGCCGTTTCCAGCGCCAACCATCACAAAGCTCACCATGTTAGAACTGGGAC
TTGCGAGGTTGTGGCGCTGCACAGATGCTGTAATAAGAACAAGATAGAAGAACGGTCCCAAACGGTCAAG
TGCTCCTGCTTCCCTGGGCAGGTGGCAGGCACTACCCGAGCTGCTCCGTCTTGTGTGGATGCATCCATAG
TGGAACAAAAGTGGTGGTGTCATATGCAGCCATGCCTGGAGGGAGAGGAATGTAAAGTCCTTCCAGATCG
CAAAGGATGGAGCTGTTCCTCTGGAAACAAAGTAAAAACAACTAGGGTAACCCATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_182807
ORF Size 408 bp
Insert Size 408
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_182807.3, NP_877959
RefSeq Size 4364
RefSeq ORF 408
Locus ID 268354
Cytogenetics 10|10 D2
Gene Summary This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines that act as regulators of immune and nervous cells. [provided by RefSeq, Jul 2008].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.