Klk8 (NM_008940) Mouse Untagged Clone

CAT#: MC214245

Klk8 (untagged) - Mouse kallikrein related-peptidase 8 (Klk8), (10ug)


  "NM_008940" in other vectors (4)

Reconstitution Protocol

USD 450.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Klk8"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Klk8
Synonyms BS; BSP1; NP; Nrpn; Pr; Prss19
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC214245 representing NM_008940
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGACGCCCCCCACCCTGTGCAATCCAGCCGTGGATCCTTCTGCTTCTGTTCATGGGAGCGTGGGCAG
GGCTCACCAGAGCTCAGGGCTCCAAGATCCTGGAAGGTCGAGAGTGTATACCCCACTCCCAGCCTTGGCA
GGCAGCCTTGTTCCAGGGCGAGAGACTGATCTGTGGGGGTGTCCTGGTTGGAGACAGATGGGTCCTCACG
GCAGCCCACTGCAAAAAACAGAAGTACTCCGTGCGTCTGGGTGATCATAGCCTCCAGAGCAGAGATCAGC
CGGAGCAGGAGATCCAGGTGGCTCAGTCTATCCAGCATCCTTGCTACAACAACAGCAACCCAGAAGATCA
CAGTCACGATATAATGCTCATTCGACTGCAGAACTCAGCAAACCTCGGGGACAAGGTGAAGCCGGTCCAA
CTGGCCAATCTGTGTCCCAAAGTTGGCCAGAAGTGCATCATATCAGGCTGGGGCACTGTCACCAGCCCTC
AAGAGAACTTTCCAAACACCCTCAACTGTGCGGAAGTGAAAATCTATTCCCAGAACAAGTGTGAGAGAGC
CTATCCAGGGAAGATCACCGAGGGCATGGTCTGTGCTGGCAGCAGCAATGGAGCTGACACGTGCCAGGGT
GACTCAGGAGGCCCTCTGGTGTGCGACGGGATGCTCCAGGGCATCACCTCATGGGGCTCAGACCCCTGTG
GGAAACCCGAGAAACCTGGAGTCTACACCAAAATCTGCCGCTACACTACCTGGATCAAGAAGACCATGGA
CAACAGGGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_008940
Insert Size 783 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC055895, AAH55895
RefSeq Size 1322 bp
RefSeq ORF 783 bp
Locus ID 259277
UniProt ID Q61955
Cytogenetics 7 28.26 cM
Gene Summary This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. Mice lacking the encoded protein exhibit impaired long-term potentiation and increased anxiety, as well as a hyperkeratosis phenotype. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, May 2016]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.