Olfr723 (NM_001011530) Mouse Untagged Clone

CAT#: MC214238

Olfr723 (untagged) - Mouse olfactory receptor 723 (Olfr723), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Olfr723 (NM_001011530) Mouse Untagged Clone
Symbol Olfr723
Synonyms MOR247-3P; MOR247-4
Vector pCMV6-Entry
Sequence Data
>MC214238 representing NM_001011530
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATTATGAAAATGGATCAGCTGTGACAGAATTTATTTTAGTGGGATTTTCCGGAAACTGGCAACTTC
AAATTTTCTTCTTTGTGACATTTACTTTGATCTATGGTGCTACTGTGGTGGGCAACATCCTTATTATAGT
CACAGTGGCAGCTAATTCTGCCCTTCATTCTCCCATGTACTTTCTTCTTGGAAACCTCTCCTTCCTGGAC
ATGTGTCTTTCCACTGTCACGACACCCAAGATGATCTCAGACTTGCTTGCAGCACACAAGAGCATCTCTT
TTCAGGGCTGCATGGCCCAGATGTTCTTCATGCATTTCTTTGGGGGTGCTGAAATGACCCTTTTGATAGT
CATGGCCTTCGACAGGTATGTGGCCATATGCAAACCTTTGCACTACAGGATAATCATGAGTCACAAGTTG
CTGAACAGGTTTATTATCCTTTCCTGGACAATTGGTTTCATACACACAATGAGCCAGATGGCATTGACAG
TGAATTTGCCTTTCTGTGGACACAATATTATAAATAATATATTTTGCGACCTTCCCCTGGTAATCAAGCT
TGCTTGTATTGAAACATACACTCTAGAGTTGTTTGTGATTGCTGACAGTGGGCTGCTCTCCTTTATCTCT
TTCTTCCTCTTGCTTGTTTCCTATACTGTCATTCTGCTCATTGTAAAGCACAAATCACCTGGCAGTCTCT
CCAAGGCGCTGTCCACATTGTCTGCTCACATAATTGTGGTCACTCTGTTCTTTGGACCCTGTATTTTTAT
CTATGCCTGGCCATTTGGGAGTTTTGCAAGCAATACAACTCTTGCTGTATTTTACACTGTTATCACACCT
TTACTGAATCCTATTATTTACACACTGAGAAATCAGGAAATGAAGAAAGCCATGAGAAAATTATGGATCC
AACAAGTCAGCTGCACATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001011530
ORF Size 930 bp
Insert Size 930
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001011530.2, NP_001011530
RefSeq Size 1006
RefSeq ORF 930
Locus ID 259147
Cytogenetics 14|14 C1
Gene Summary Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.