Olfr1348 (NM_146913) Mouse Untagged Clone

SKU
MC214044
Olfr1348 (untagged) - Mouse olfactory receptor 1348 (Olfr1348), (10ug)
  $330.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Olfr1348
Synonyms MOR103-9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC214044 representing NM_146913
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTAGATCCTTGGAGCTGGCCAACATGACCAGGGTTCAGAAGTTCCTCTTGCTGGGATTGTCCACTA
GGCTGGACATAAGGGATGCCCTATTTGCTGTCTTCCTGACTCTTTACCTGCTGACACTTGTGGAGAACAC
ACTCATCATCTACCTCATCTTCAGTCACAAAGAGCTCCACAAGCCCATGTACTTCTTCCTGGGCAACCTC
AGCTGCCTGGAGATGTGCTATGTGTCAGTCACCATGCCCACCTTACTTGTGGGTCTATGGACGGGGCCCT
ACCACATTCCCTTCACACTCTGCATGACACAACTCTTCTTCTTTATAGTCCTCATCTGCACAGAGTGCAC
CCTCTTGGCTTCCATGGCTTATGATCGCTATGTGGCCATCTGCCGCCCACTACACTACCCACTGCTCATG
AGGCCCCAAGTATGTTTGGGCTTAGCCTTGTCTTCATGGCTAGGTGGGCTGATTGTCTCAGTGGCCAAAA
CAACATGCATTGCCAGTCTGTCTTACTGTGGCCCCAATGTCCTCAACCAATTTTTCTGTGATGTCTCCCC
TCTGCTCAATTTGTCCTGTACCCATGTGGCCCTCACAGAGCTGGTAGACTTCATCTCAGCCATTGTCATC
TTCTGTGGAACACTCTTGGTGTCCCTAGCCTCCTATTCAGCTATTGGGATGGCTGTACTCCGCATGCCAT
CAGCTGCTGCCCGGCGCAAGGCCTTCTCCACCTGTGCCTCCCATCTGGTAGTGGTGGGCATCTTTTACTC
AGCAGCTCTCTTCATCTATTGCCGCCCCAGCCGCATCAAGTCCATGGACCTCAACAAGGTGCTGTCTGTC
ATCTACACAGTGGTCACACCTCTCTGCAACCCTATCATCTACTGTCTGAGAAATAAGGAGGTCCACACTG
TGCTGAAAAAGACTCTCCATTGGCCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_146913
Insert Size 939 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_146913.1, NP_667124.1
RefSeq Size 939 bp
RefSeq ORF 939 bp
Locus ID 258915
Cytogenetics 7 A1
Summary Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. provided by RefSeq, Jul 2008
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_146913" in other vectors (4)
SKU Description Size Price
MG213551 Olfr1348 (tGFP-tagged) - Mouse olfactory receptor 1348 (Olfr1348), (10ug) 10 ug
$500.00
MR213551 Olfr1348 (Myc-DDK-tagged) - Mouse olfactory receptor 1348 (Olfr1348) 10 ug
$289.00 $300.00
MR213551L3 Lenti ORF clone of Olfr1348 (Myc-DDK-tagged) - Mouse olfactory receptor 1348 (Olfr1348) 10 ug
$600.00
MR213551L4 Lenti ORF clone of Olfr1348 (mGFP-tagged) - Mouse olfactory receptor 1348 (Olfr1348) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products