Dusp15 (NM_145744) Mouse Untagged Clone
CAT#: MC213259
Dusp15 (untagged) - Mouse dual specificity phosphatase-like 15 (Dusp15), transcript variant 2, (10ug)
"NM_145744" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Dusp15 |
Synonyms | AI851682; LMW-DSP10; T-DSP10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC213259 representing NM_145744
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGAATGGCATGACCAAGGTACTTCCTGGACTCTACCTTGGAAACTTCATTGATGCCAAAGACCCGG ATCAGCTGGGCCGGAATAAGATCACACATATCATCTCTATCCACGAATCACCCCAGCCTCTGTTGCAGGA TATCACCTACCTTCGAATCTCAGTGTCTGATACTCCTGAGGTACCCATCAAAAAGCACTTCAAAGAATGC GTCCACTTTATCCACTCCTGCCGCCTCAACGGGGGTAACTGCCTTGTGCACTGGCCTTTGAAGCATGAAT GCAGGGCTAGGTCTCTGAGTCTTCTCCAGTGCTCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_145744 |
Insert Size | 318 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_145744.2, NP_665687.1 |
RefSeq Size | 538 bp |
RefSeq ORF | 318 bp |
Locus ID | 252864 |
UniProt ID | Q8R4V2 |
Cytogenetics | 2 H1 |
Gene Summary | May dephosphorylate MAPK13, ATF2, ERBB3, PDGFRB and SNX6 (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded protein (isoform 2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218978 | Dusp15 (tGFP-tagged) - Mouse dual specificity phosphatase-like 15 (Dusp15) transcript variant 2, (10ug) |
USD 350.00 |
|
MR218978 | Dusp15 (Myc-DDK-tagged) - Mouse dual specificity phosphatase-like 15 (Dusp15), transcript variant 2 |
USD 150.00 |
|
MR218978L3 | Lenti ORF clone of Dusp15 (Myc-DDK-tagged) - Mouse dual specificity phosphatase-like 15 (Dusp15), transcript variant 2 |
USD 450.00 |
|
MR218978L4 | Lenti ORF clone of Dusp15 (mGFP-tagged) - Mouse dual specificity phosphatase-like 15 (Dusp15), transcript variant 2 |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review