Prok1 (NM_001044382) Mouse Untagged Clone
CAT#: MC213248
Prok1 (untagged) - Mouse prokineticin 1 (Prok1), (10ug)
"NM_001044382" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Prok1 |
Synonyms | EG-VEGF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC213248 representing NM_001044382
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGAGGCGCTGTGCATATCTTCATCATGCTCCTTCTAGCAACGGCGTCCGACTGTGCGGTCATCACAG GGGCCTGTGAACGAGATATCCAGTGTGGGGCCGGCACCTGCTGCGCTATCAGTCTGTGGCTGCGGGGCCT GCGGTTGTGTACCCCACTGGGGCGTGAAGGAGAGGAGTGCCACCCAGGAAGCCACAAGATCCCCTTCTTG AGGAAACGCCAACACCATACCTGTCCCTGCTCACCCAGCCTGCTGTGCTCCAGGTTCCCGGACGGCAGGT ACCGCTGCTTCCGGGACTTGAAGAATGCCAACTTTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001044382 |
Insert Size | 318 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001044382.1, NP_001037847.1 |
RefSeq Size | 414 bp |
RefSeq ORF | 318 bp |
Locus ID | 246691 |
UniProt ID | Q14A28 |
Cytogenetics | 3 F2.3 |
Gene Summary | Potently contracts gastrointestinal (GI) smooth muscle. Induces proliferation, migration and fenestration (the formation of membrane discontinuities) in capillary endothelial cells. Induces proliferation and differentiation, but not migration, of enteric neural crest cells. Directly influences neuroblastoma progression by promoting the proliferation and migration of neuroblastoma cells. Positively regulates PTGS2 expression and prostaglandin synthesis. May play a role in placentation. May play a role in normal and pathological testis angiogenesis.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG220338 | Prok1 (tGFP-tagged) - Mouse prokineticin 1 (Prok1), (10ug) |
USD 350.00 |
|
MR220338 | Prok1 (Myc-DDK-tagged) - Mouse prokineticin 1 (Prok1) |
USD 150.00 |
|
MR220338L3 | Lenti ORF clone of Prok1 (Myc-DDK-tagged) - Mouse prokineticin 1 (Prok1) |
USD 450.00 |
|
MR220338L4 | Lenti ORF clone of Prok1 (mGFP-tagged) - Mouse prokineticin 1 (Prok1) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review