Nanos3 (NM_194059) Mouse Untagged Clone

CAT#: MC213198

Nanos3 (untagged) - Mouse nanos homolog 3 (Drosophila) (Nanos3), (10ug)

USD 402.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Nanos3 (NM_194059) Mouse Untagged Clone
Symbol Nanos3
Synonyms nos3
Vector pCMV6-Entry
Sequence Data
>MC213198 representing NM_194059
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGACTTTCAATCTTTGGACAGATTACCTAGGTCTGGCAAGACTGGTTGGGGCTCTGCATAAGGAAG
AGGAGCTTGATGTAAGGCTGGATCCCAAACCAGAGCCCAAGCCAAGTTCAGAAAGCCAGCAAGCCAGCAA
GGAATCCTCTGCAGCTCCTGAACGCTTATGTTCATTCTGCAAACACAATGGCGAGTCCCGTGCCATCTAT
CAGTCCCATGTCCTGAAGGATGAGGCAGGGCGGGTGCTGTGTCCCATTTTGCGGGATTATGTGTGTCCCC
AGTGTGGGGCCACTCAGGAGCATGCCCACACTCGACGCTTTTGCCCACTCACCAGCCAGGGCTACACTTC
TGTCTACTGCTACACCACCCGGAATTCTGCAGGCAAAAAGCTGACCCGGCCTGACAAGGCAAAGACACAG
GATGCTGGCCACCGCCTTGGAGGAGAAGCAGCAGCAGGTGTCTATGCAGGTTCCAAAAGTGGCAGGAAGC
CCCCTGGACCTTCACCCTCGGCCTGCTGTCCCTCCACTACGGCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_194059
ORF Size 537 bp
Insert Size 537
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_194059.2, NP_918948
RefSeq Size 730
RefSeq ORF 537
Locus ID 244551
Cytogenetics 8|8 C2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.