H1f10 (NM_198622) Mouse Untagged Clone

CAT#: MC213169

H1fx (untagged) - Mouse H1 histone family, member X (H1fx), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: H1f10
• Synonyms: Gm461; H1-10; H1.10; H1fx; H1X
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC213169 representing NM_198622
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCGGTGGAGCTTGAGGAGGCCCTGCCGCCAACGAGCGCCGACGGGACGGCCCGCAAGACGGCCAAGG
  CCGGCGGCTCTGCGGCGCCCACGCAGCCCAAGAGAAGGAAGAACCGCAAGAAGAACCAGCCAGGCAAGTA
  CAGCCAGCTGGTGGTGGAGACCATCCGCAAGCTGGGGGAGCGCGGCGGCTCGTCTCTGGCGCGCATCTAC
  GCTGAGGCCAGGAAGGTGGCATGGTTCGACCAGCAGAACGGGCGCACCTACCTCAAGTACTCTATCCGGG
  CGCTGGTGCAGAACGATACGCTACTGCAGGTGAAGGGCACCGGCGCCAACGGATCCTTCAAGCTGAACCG
  CAAGAAGCTGGAGGGCGGCGCGGAGCGGCGCGGAGCTTCGGCGGCCAGCAGCCCCGCGCCCAAGGCGCGC
  ACGGCGGCGGCGGACAGAACGCCCGCCAGGCCGCAGCCGGAGCGGCGCGCGCACAAGAGCAAGAAGGCGG
  CGGCTGCTGCCAGCGCGAAGAAAGTGAAGAAGGCGGCCAAACCCAGCGTGCCCAAGGTGCCCAAGGGCCG
  CAAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_198622
• Insert Size: 567 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_198622.1, NP_941024.1
• RefSeq Size: 1126 bp
• RefSeq ORF: 567 bp
• Locus ID: 243529
• Cytogenetics: 6 D1
• Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H1 family. [provided by RefSeq, Nov 2015]