Ccnb1ip1 (NM_001111119) Mouse Untagged Clone

CAT#: MC213064

Ccnb1ip1 (untagged) - Mouse cyclin B1 interacting protein 1 (Ccnb1ip1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ccnb1ip1
• Synonyms: Gm288; Hei10; mei4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC213064 representing NM_001111119
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCTTTGTGTGAAGACATGCTGCTTTGCAATTATCGGAAGTGTCGGATCAAGCTCTCTGGTTATGCTT
  GGGTCACTGCCTGTTCTCACATCTTCTGCGATCAGCACGGCAGCGGGGAGTTCAGTCGTTCACCAGCGAT
  CTGTCCTGCTTGCAACAGTACCCTTTCTGGAAAGCTAGATATTGTTCGAACAGAACTCAGTCCATCAGAG
  GAGTACAAAGCTATGGTATTGGCAGGGCTTCGCCCAGAGGTTGTTTTGGACATTAGCTCCCGGGCATTGG
  CCTTCTGGACATACCAGGTACACCAGGAGCGTCTCTATCAAGAGTATAATTTCAGCAAGGCCGAGAACCA
  CTTAAAACAGATGGAGAAGATGTATATGCAGCAAATACAGAGCAAGAATATAGAATTGACCTCTATGAAA
  GGGGAGGTTATTTCCATGAAGAAAGTTCTAGAAGAATACAAGAAAAAGTTTAGTGACATCTCTGAAAAAC
  TTATGGAGCGTAATCGCCAGTACCAAAAGCTCCAAGGCCTTTATGATAGCCTTAGGCTAAGAAATATCAC
  TATCGCCAGCCAAGAAGGCTCCCTGGAACCAGGTATGATCCCGCAGTCTGGAGTCTTTGGCTTCCCACCA
  GGGAATAACTCAAAGTTTTCTTTGGACCATATACCAGTTGGAAATCAAGGTGGTGGAGATGAAGATGTTC
  AGTTCAGACCATTTTTTGTGTGTTCTCCCACAGCGCCTGAACCCATTAACAACTTCTTTAGTTTTGCATC
  TCCAAGCCATGAAGCAGAGCAGCAAGTCTGCAGCAGGGCCTTTAAAGCAAAAAGAATTTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001111119
• Insert Size: 831 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001111119.1, NP_001104589.1
• RefSeq Size: 1508 bp
• RefSeq ORF: 831 bp
• Locus ID: 239083
• UniProt ID: D3Z3K2
• Cytogenetics: 14 C1
• Gene Summary: Ubiquitin E3 ligase that acts as a limiting factor for crossing-over during meiosis: required during zygonema to limit the colocalization of RNF212 with MutS-gamma-associated recombination sites and thereby establish early differentiation of crossover and non-crossover sites. Later, it is directed by MutL-gamma to stably accumulate at designated crossover sites. Probably promotes the dissociation of RNF212 and MutS-gamma to allow the progression of recombination and the implementation of the final steps of crossing over. Modulates cyclin-B levels and participates in the regulation of cell cycle progression through the G2 phase. Overexpression causes delayed entry into mitosis.[UniProtKB/Swiss-Prot Function]