Slc25a44 (NM_178696) Mouse Untagged Clone

CAT#: MC212861

Slc25a44 (untagged) - Mouse solute carrier family 25, member 44 (Slc25a44), transcript variant 1, (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Slc25a44 (NM_178696) Mouse Untagged Clone
Symbol Slc25a44
Synonyms 6720482A19; B430110G05Rik
Vector pCMV6-Entry
Sequence Data
>MC212861 representing NM_178696
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCGGGGACTCTGAATTGGCCGTGCAAGAGCCTGACAGAAGGTCTCCGGGCACAATGGAGGACAAAC
GGAACATCCAGATCATCGAGTGGGAGCACCTGGACAAGAAGAAGTTCTATGTGTTTGGTGTTGCTATGAC
AATGATGATCAGGGTCAGCGTGTACCCGTTCACCCTCATCCGCACCCGCCTGCAGGTCCAGAAGGGCAAG
AGCCTCTACCACGGGACCTTCGATGCCTTTGTCAAGATCCTGCGAGCAGATGGAGTGGCGGGCCTCTACC
GGGGGTTCCTGGTCAACACCTTCACACTCATCTCCGGCCAGTGCTATGTCACCACTTACGAGCTCACCCG
GAAGTTTGTGGCAGACTACAGCCAGAGTAACACAGTCAAATCACTCGTAGCCGGGGGCTCGGCCTCCCTT
GTGGCCCAGAGCATCACGGTGCCGATCGATGTTGTCTCCCAACATCTGATGATGCAGCGGAAGGGTGAGA
AAATGGGTCGCTTCCAAGTGCACGGGAACCTAGAGGGACAAGGGGTGATTGCCTTTGGCCAGACTAAGGA
CATCATCAGGCAGATCCTTCGGGCTGACGGTCTCCGAGGCTTCTACCGGGGCTATGTGGCCTCGCTGCTA
ACGTACATCCCAAACAGTGCTGTCTGGTGGCCCTTCTACCACTTCTATGCAGAGCAGCTGTCGCGCCTGT
GCCCTCAGGAGTGCCCTCACATTGTCTTTCAAGCCATCTCTGGGCCCCTGGCTGCAGCCACTGCCTCCAT
CCTCACCAATCCCATGGATGTCATCAGAACCCGTGTGCAGGTTGAAGGCAAGAGCTCCATCGTCCTGACC
TTCAGGCAGCTGATGGCAGAGGAGGGGCCTTGGGGCCTCATGAAGGGCCTCTCGGCAAGAATCATCTCGG
CTACACCCTCCACCATCGTCATCGTGGTGGGCTACGAGAGCCTCAAGAAGCTCAGCCTGCGACCTGAGCT
GGTGGACTCGAGACACTGGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_178696
ORF Size 1002 bp
Insert Size 1002
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_178696.5, NP_848811
RefSeq Size 3584
RefSeq ORF 1002
Locus ID 229517
Cytogenetics 3|3 F1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.