Arfgap1 (NM_001177709) Mouse Untagged Clone

CAT#: MC212847

Arfgap1 (untagged) - Mouse ADP-ribosylation factor GTPase activating protein 1 (Arfgap1), transcript variant 3, (10ug)


  "NM_001177709" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Arfgap1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Arfgap1
Synonyms AI115377; Arf1gap
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212847 representing NM_001177709
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAGCCCAAGAACCAGGAAAGTTCTTAAGGAAGTCCGGGCACAGGATGAGAATAATGTTTGCTTTG
AGTGTGGTGCGTTCAATCCTCAGTGGGTCAGCGTGACTTATGGCATCTGGATCTGCCTGGAATGCTCTGG
GAGACACCGTGGGCTTGGGGTGCACCTCAGCTTTGTGCGCTCTGTTACAATGGACAAATGGAAGGACATT
GAGCTGGAGAAGATGAAGGCTGGTGGGAATGCTAAGTTCCGAGAGTTCCTGGAGACACAGGACGACTATG
AGCCTAGCTGGTCACTGCAGGACAAGTACAGCAGCAGAGCCGCGGCGCTCTTCAGGGATAAGGTGGCTAC
TTTGGCAGAAGGTAAAGAGTGGTCTCTGGAGTCATCGCCTGCACAGAACTGGACCCCACCTCAGCCCAAG
ACACTGCAGTTCACTGCCCACCGAGCCTCTGGCCAGCCACAGAGTGCAGCCGCCTCTGGGGACAAGGCTT
TTGAAGATTGGCTGAATGATGACCTGGGTTCCTACCAGGGTGCTCAGGAGAATCGCTATGTAGGGTTTGG
GAACACAGTGCCACCTCAGAAGAGAGAAGATGACTTCCTCAACAATGCCATGTCATCGCTGTACTCGGGC
TGGAGCAGTTTTACCACTGGGGCGAGCAAGTTTGCATCTGCAGCAAAGGAGGGTGCTACAAAATTTGGAT
CTCAAGCAAGTCAGAAGGCTTCGGAGTTGGGCCACAGCCTGAATGAGAATGTTCTCAAGCCTGCACAGGA
GAAGGGAGTTGGCAGTAAGGGATGGCGTGATGTCACTACTTTCTTCTCTGGGAAAGCCGAAGACTCTTCA
GACAGACCCTTAGAGGGCCACAGCTACCAGAACAGCAGTGGAGACAACTCTCAGAACAGCAACATAGACC
AGAGCTTCTGGGAGACCTTTGGGAGTGCTGAGCCCCCCAAGGCCAAGTCCCCAAGCAGTGACAGCTGGAC
CTGTGCAGATGCTTCAACAGGGAGGAGGAGCTCGGACAGCTGGGACGTTTGGGGCTCAGGTTCCGCATCC
AACAACAAGAACAGCAATAGCGATGGCTGGGAGAGTTGGGAGGGAGCCAGTGGGGAGGGCAGGGCAAAGG
CCACCAAGAAGGCAGCCCCATCCACGGCTGATGAGGGCTGGGACAACCAGAACTGGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001177709
Insert Size 1179 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001177709.1, NP_001171180.1
RefSeq Size 2442 bp
RefSeq ORF 1179 bp
Locus ID 228998
UniProt ID Q9EPJ9
Cytogenetics 2 103.53 cM
Gene Summary GTPase-activating protein (GAP) for the ADP ribosylation factor 1 (ARF1). Involved in membrane trafficking and /or vesicle transport. Promotes hydrolysis of the ARF1-bound GTP and thus, is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles, a prerequisite for vesicle's fusion with target compartment. Probably regulates ARF1-mediated transport via its interaction with the KDELR proteins and TMED2. Overexpression induces the redistribution of the entire Golgi complex to the endoplasmic reticulum, as when ARF1 is deactivated. Its activity is stimulated by phosphoinosides and inhibited by phosphatidylcholine (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and lacks an alternate in-frame exon and uses an alternate splice site in the 3' coding region, compared to variant 1. The resulting isoform (b) lacks an internal segment near the C-terminus, compared to isoform a. Both variants 2 and 3 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.