Smox (NM_001177839) Mouse Untagged Clone

CAT#: MC212826

Smox (untagged) - Mouse spermine oxidase (Smox), transcript variant 8, (10ug)

USD 402.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Smox (NM_001177839) Mouse Untagged Clone
Symbol Smox
Synonyms B130066H01Rik; PAO; PAOh1; SMO
Vector pCMV6-Entry
Sequence Data
>MC212826 representing NM_001177839
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAAAGTTGTGAATCCAGTGGCGACAGTGCGGATGACCCTCTCAGTCGTGGCCTACGGAGAAGGGGAC
AGCCTCGTGTGGTGGTGATCGGTGCTGGCTTGGCTGGCCTGGCTGCAGCTAGAGCCCTTCTGGAGCAGGG
CTTCACGGATGTCACTGTGCTTGAGGCTTCCAGCCACATTGGGGGCCGTGTGCAGAGTGTGAGGCTTGGA
GACACCACCTTTGAGCTGGGAGCCACCTGGATCCATGGATCCCACGGGAATCCTATCTATCAACTAGCAG
AAGCCAATGGCCTTTTGGAAGAGACAACAGATGGGGAGCGCAGTGTGGGCCGCATCAGCCTTTACTCCAA
GAATGGCGTGGCCTGCTACCTTACCAACCGTGGCTGCCGCATCCCCAAGGACGTGGTTGAGGAATTCAGC
GATTTATACAACGAGGTCTATAACATGACCCAGGAGTTCTTCCGGCATGGTAAACCAGTCAATGCCGAGA
GTCAGAACAGCGTCGGGGTGTTCACCCGGGAGAAGGTGCGGAATCGCATCAGGGATGACCCTGACGACAC
AGAGGCCACCAAGCGCCTGAAGCTCGCCATGATCCAGCAGTACCTGAAGGGAACCCCAATATACCAAAAC
CTAGGCGAATCCTGCGCTCAGCCTGGGGCAGCAACCCATACTTCCGGGGTTCCTATTCCTACACACAGGT
GGGCTCAAGTGGGGCGGATGTGGAGAAGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001177839
ORF Size 732 bp
Insert Size 732
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001177839.1, NP_001171310
RefSeq Size 1430
RefSeq ORF 732
Locus ID 228608
Cytogenetics 2|2 F1
Gene Summary Flavoenzyme which catalyzes the oxidation of spermine to spermidine. Can also use N(1)-acetylspermine and spermidine as substrates, with different affinity depending on the isoform (isozyme) and on the experimental conditions. Plays an important role in the regulation of polyamine intracellular concentration and has the potential to act as a determinant of cellular sensitivity to the antitumor polyamine analogs. May contribute to beta-alanine production via aldehyde dehydrogenase conversion of 3-amino-propanal. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.