Nemp2 (NM_001142647) Mouse Untagged Clone

CAT#: MC212794

Tmem194b (untagged) - Mouse transmembrane protein 194B (Tmem194b), transcript variant 1, (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Nemp2 (NM_001142647) Mouse Untagged Clone
Symbol Nemp2
Synonyms 5330401P04Rik; 9830163O08; Tmem194b
Vector pCMV6-Entry
Sequence Data
>MC212794 representing NM_001142647
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGCCTAGGTTGTGGTGGCTGGTGCTCTGGCTGCAGCCCCTGGCTACACTGCCAGCGAGCGCGGTGC
ACGACGAGGAGGCAGCGATGTCAGTTCCCAGATGTAAATCTCTGAAGGAAACGGACTTAATTAAAACTTC
TGTGTCAGACTGCTATTGCTACAATCAACATTCGCAAATCCAGTGGACATATATGTGGTCAACTGTGCAG
GTGACAGTAACCAGCCCGGGCCTGCTCAATATTGTATATATCACAGGAAGTCATAACTGCCAGCACACAG
AAAGCATTTTATCATTTATCAAATGTGTGACTCATAACTTTTGGGCACCAGAGGAGGCTGAGGAGATAAC
CATAGTCTTCAGTCCATATGGAGAAACTGTGTGCTTCTCTGTGAAGCCTGTTGGGAGGCTCCTTCCCTAC
ATAGTAAGCGTGAGTCGAAACATTGTGGATTTCAAACTCTTCCTTGTGTTTGTGACAGGCATTTTCCTTT
TCTTGTATGCAAAGACCTTGAGCCAAAGCCCTGTTTTCTATTACTCTTCCGGTACCGTGTTAGGTATTCT
AATGACATTAGTCTTTGTCCTTCTGATGGCTAAGAAACACATTCCAAAGTATAGCACATTTGGGGCGCTA
ATGATTGGTTGTTGGTTTGCTTCAGTTTATGTTTTGTGCCAGTTGATGGAAGATCTGAAGTGGCTGTGGT
ATGGAAACAGAATGTATATATTAGGCTATGTGGTGGTTGTTGGACTTTGTAGCTTTGCTGCCTGTTACAG
TCACGGGCCTCTTGCTGATGAGGGGAGCAGAGACCTTCTCATGTGGACCCTGAGGCTCTTCTCCCTGGCT
CTGGTCTACACTGGTGTGGCCGCTCCTCAGTTTGCCTATGCTGTTCTGATCGTCCTCTTGTTCTCCTGGA
GTCTGCACTATCTCCTGAGAGCATTCAGCTATCTCAGGTGGAAAATGAGGCCGTGGTTCACAGCAGAACC
TCAGGTGGCGAGGTATCTCACTGATGACGAGTACAGGGAGCAAGCTGAAGCTGCAACAGCCAGGGCTCTC
GAGGAACTGCGCCAAGCCTGCTGCAGGCCTGACTTCCCTTCCTGGCTGGCTGTCTCCAGACTCCAGGCTC
CTAAAAAGTTTGCAGAGTTTGTTCTTGGAGCCAGCCACCTGTCACCAGAGGAAGTCAGCACACATGAAAA
GCAGTATGGCCTTGGGGGTGCCTTCCTGGAGGAACAGCTCTTTAGCCTGCAGACTGACAGTCTACCTGCA
AGTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001142647
ORF Size 1266 bp
Insert Size 1266
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001142647.1, NP_001136119
RefSeq Size 3423
RefSeq ORF 1266
Locus ID 227094
Cytogenetics 1|1 C1.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.