Ticam2 (NM_173394) Mouse Untagged Clone

CAT#: MC212757

Ticam2 (untagged) - Mouse toll-like receptor adaptor molecule 2 (Ticam2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ticam2
• Synonyms: B430113A10; TICAM-2; Tirp; TRAM; Trif
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212757 representing NM_173394
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGTGTTGGGAAGTCTAAACTAGATAAGTGCCCCCTTTCTTGGCATAAAAAAGACAGTGTGGATGCCG
  ATCAAGACGGCCATGAGTCAGACTCCAAGAATTCTGAGGAAGCCTGCTTGCGTGGTTTTGTGGAGCAGAG
  CAGTGGATCAGAGCCACCAACAGGAGAGCAGGACCAACCTGAGGCAAAGGGGGCGGGGCCTGAGGAGCAA
  GATGAAGAAGAGTTCCTCAAATTTGTGATACTTCATGCAGAAGATGACACCGACGAGGCCCTCAGAGTCC
  AGGATCTACTGCAAAACGACTTTGGTATCAGGCCGGGGATCGTTTTCGCCGAGATGCCGTGCGGAAGACT
  GCATTTGCAGAATCTAGACGATGCGGTCAATGGGTCGGCCTGGACCATCTTGTTACTGACTGAGAACTTC
  CTAAGAGACACCTGGTGTAACTTCCAGTTCTACACTTCCCTGATGAATTCTGTGAGCAGGCAGCACAAGT
  ACAACTCCGTCATACCCATGCGGCCCCTGAACAGCCCTCTTCCCCGGGAACGGACTCCCTTGGCGCTGCA
  AACCATCAATGCCTTAGAGGAAGAAAGTCAAGGCTTTTCCACACAAGTGGAGAGAATTTTCCGGGAGTCT
  GTATTTGAGAGGCAACAAAGTATATGGAAAGAGACACGAAGTGTGTCGCAGAAACAGTTCATTGCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_173394
• Insert Size: 699 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_173394.3, NP_775570.1
• RefSeq Size: 3264 bp
• RefSeq ORF: 699 bp
• Locus ID: 225471
• UniProt ID: Q8BJQ4
• Cytogenetics: 18 C
• Gene Summary: Functions as sorting adapter in different signaling pathways to facilitate downstream signaling leading to type I interferon induction. In TLR4 signaling, physically bridges TLR4 and TICAM1 and functionally transmits signal to TICAM1 in early endosomes after endocytosis of TLR4. In TLR2 signaling, physically bridges TLR2 and MYD88 and is required for the TLR2-dependent movement of MYD88 to endosomes following ligand engagement. Involved in IL-18 signaling and is proposed to function as a sorting adapter for MYD88 in IL-18 signaling during adaptive immune response. Forms a complex with RAB11FIP2 that is recruited to the phagosomes to promote the activation of the actin-regulatory GTPases RAC1 and CDC42 and subsequent phagocytosis of Gram-negative bacteria.[UniProtKB/Swiss-Prot Function]