Lclat1 (NM_001177968) Mouse Untagged Clone

CAT#: MC212744

Lclat1 (untagged) - Mouse lysocardiolipin acyltransferase 1 (Lclat1), transcript variant 3, (10ug)


  "NM_001177968" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Lclat1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Lclat1
Synonyms Agpat8; AI181996; Alcat1; Gm91; Lycat
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212744 representing NM_001177968
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGTCATGGAAGGGGATTTACTTTATACTCTTCCTGTTTGCTGGAAGCTTTTTTGGAAGTATTTTTA
TGCTCGGCCCCATTTTACCTTTGATGTTTATAAACCTGTCGTGGTATCGCTGGATTAGCAGCCGTCTTGT
GGCTACATGGCTCACACTTCCTGTGGCATTGCTGGAGACCATGTTTGGTGTGAGAGTGGTTATAACAGGT
GACGCCTTTGTGCCTGGAGAGCGGAGCGTCATCATCATGAACCACCGGACACGTGTGGACTGGATGTTCC
TGTGGAACTGTCTAATGAGGTACAGCTACCTCAGGGTGGAGAAGATTTGCCTCAAATCCAGTCTCAAAAG
TGTTCCTGGATTCGGCTGGGCCATGCAAGTTGCGGCCTTTATCTTTATTCATAGGAAGTGGAAGGATGAT
AAGAGCCATTTTGAAGACATGATTGATTATTTTTGTGCCATCCATGAACCACTACAGCTTCTCATTTTTC
CAGAAGGAACTGACCTCACAGAAAATAATAAGGCTAGGAGTAATGATTTTGCTGAGAAGAACGGACTTCA
GAAATATGAGTATGTTTTACACCCAAGAACCACTGGCTTTACCTTTGTGGTGGACCGCCTAAGAGAAGGG
AAGAACCTCGATGCTGTTCATGACATCACGGTCGCATATCCTTACAACATCCCTCAAACTGAGAAGCACC
TTCTCCTTGGAGACTTTCCCAAGGAGATCCACTTCCACGTCCAGCGGTATCCAGCTGACTCTCTTCCCAC
ATCCAAGGAGGACCTTCAGCTCTGGTGCCACAGAAGGTGGGAAGAAAAGGAGGAGAGGCTTCGGTCCTTC
TACCAAGGAGAGAAAAACTTCCACTTTACTGGGCAGAGTACAGTTCCACCTTGCAAGTCTGAGCTCAGAG
TCCTTGTGGTCAAGCTACTGTCCATAGTGTACTGGGCCTTGTTCTGCTCTGCAATGTGCCTGCTCATATA
TCTGTACAGCCCTGTTCGGTGGTATTTTATAATCAGCATTGTGTTCTTCGTGCTGCAGGAGAGAATATTT
GGTGGACTGGAAATCATTGAACTTGCATGTTACCGTTTTTTACACAAGCACCCACATTTAAATTCAAAGA
AAAATGAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001177968
Insert Size 1131 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001177968.1, NP_001171439.1
RefSeq Size 4444 bp
RefSeq ORF 1131 bp
Locus ID 225010
UniProt ID Q3UN02
Cytogenetics 17 E1.3- E2
Gene Summary Exhibits acyl-CoA:lysocardiolipin acyltransferase (ALCAT) activity; catalyzes the reacylation of lyso-cardiolipin to cardiolipin (CL), a key step in CL remodeling (PubMed:15152008). Recognizes both monolysocardiolipin and dilysocardiolipin as substrates with a preference for linoleoyl-CoA and oleoyl-CoA as acyl donors (PubMed:15152008). Also exhibits 1-acyl-sn-glycerol-3-phosphate acyltransferase activity (AGPAT) activity; converts 1-acyl-sn-glycerol-3- phosphate (lysophosphatidic acid or LPA) into 1,2-diacyl-sn-glycerol-3- phosphate (phosphatidic acid or PA) by incorporating an acyl moiety at the sn-2 position of the glycerol backbone (By similarity). Possesses lysophosphatidylinositol acyltransferase (LPIAT) activity (PubMed:20668164). Possesses lysophosphatidylglycerol acyltransferase (LPGAT) activity (By similarity). Required for establishment of the hematopoietic and endothelial lineages (PubMed:17675553).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.