Treml4 (NM_172623) Mouse Untagged Clone

CAT#: MC212740

Treml4 (untagged) - Mouse triggering receptor expressed on myeloid cells-like 4 (Treml4), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Treml4
• Synonyms: 5031403H21Rik; BB137214; IDCP1; TLT-4; TLT4; Treml3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212740 representing NM_172623
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCTGGAGGTACTCACAACTGCTCCTGGTCCCTGTGCAGCTGGTGTTCCTGGCCTCAGTTTGTTGTC
  CAGGTGTCTGGGGGTCCACAGTATCTGAAGAGCTTCATAGAATGGTAGGACAGAGCCTCTCCGTGCAGTG
  CCAATACAAGCCTAAGGAGGAGTCCTATGTGCTGAAAACGTGGTGTCGGCAAACAGCCCCAAGTAAATGT
  ACGAGAGTGGTCACTACCTCTGAGCCTCGGAAAGCAGCCAGGGAATTACAGCACACAATCTGGGATGATC
  CTGAAGCTGGCTTCTTCAACATCACCATGACTCAACTAACAGAGGATGACTCAGCGTTCTACTGGTGTGG
  TCCATATTATCCTTCCCTCAGAGAAGTAACTGTTCTCAGAAACATCAGCCTGGTGGTGTCGCCAGCCCCA
  TCAACCCTTCCTTCGCAGACGATTGCTCCGCTCCCAGAAAGCACAGCCACCATCTTTATGCCCTTCCCAG
  TTCTGACTACCTCTCCCGAGGAGACCACTGACTCTTCCATCAATGGCACTGGGCACAGAAACCAAAGTTC
  CTCCTCTCCTGGCTGGACCTCCCCGGGGCTTCTGGTCTCTGTGCAATATGGACTCCTCCTGCTCAAGGCC
  CTGATGCTGTCAGTTTTCTGTGTGCTTCTTTGCTGGAGGAGTGGCCAGGGACGAGAGTACATGGCAGAGA
  CGATGGAGCTTTCAAAACTACCTCACATCTCCAAGTCCTTGGACACGGTTAGCCACATCTCAGGGTATGA
  GAAGAAGGCTAACTGGTACTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_172623
• Insert Size: 792 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_172623.2, NP_766211.2
• RefSeq Size: 1742 bp
• RefSeq ORF: 792 bp
• Locus ID: 224840
• UniProt ID: Q3LRV9
• Cytogenetics: 17 C
• Gene Summary: Positively regulates Toll-like receptor signaling via TLR7, TLR9 and TLR13 in neutrophils and splenic macrophages (PubMed:25848864). Regulates TLR7 signaling by controlling ligand-induced recruitment of TLR7 from the endoplasmic reticulum to endosomes and lysosomes (PubMed:25848864). Positively regulates Toll-like receptor TLR9-induced production of inflammatory cytokines but is dispensable for IFNB1 production (PubMed:25848864). Involved in the anti-viral response to several viruses including influenza virus, vesicular stomatitis virus and cytomegalovirus (PubMed:25848864). Binds to late apoptotic, and necrotic cells, but not living or early apoptotic cells, but is not essential for uptake of dying cells by dendritic cells (DCs) (PubMed:22210914, PubMed:19155473, PubMed:25848864). Does not bind nucleic acids (PubMed:25848864). May participate in antigen presentation (PubMed:22210914).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 3. The resulting isoform (2) has the same N- and C-termini but is 1 aa shorter compared to isoform 3.