Treml4 (NM_001033922) Mouse Untagged Clone

CAT#: MC212739

Treml4 (untagged) - Mouse triggering receptor expressed on myeloid cells-like 4 (Treml4), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Treml4
• Synonyms: 5031403H21Rik; BB137214; IDCP1; TLT-4; TLT4; Treml3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212739 representing NM_001033922
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCTGGAGGTACTCACAACTGCTCCTGGTCCCTGTGCAGCTGGTGTTCCTGGCCTCAGGTGTCTGGG
  GGTCCACAGTATCTGAAGAGCTTCATAGAATGGTAGGACAGAGCCTCTCCGTGCAGTGCCAATACAAGCC
  TAAGGAGGAGTCCTATGTGCTGAAAACGTGGTGTCGGCAAACAGCCCCAAGTAAATGTACGAGAGTGGTC
  ACTACCTCTGAGCCTCGGAAAGCAGCCAGGGAATTACAGCACACAATCTGGGATGATCCTGAAGCTGGCT
  TCTTCAACATCACCATGACTCAACTAACAGAGGATGACTCAGCGTTCTACTGGTGTGGTCCATATTATCC
  TTCCCTCAGAGAAGTAACTGTTCTCAGAAACATCAGCCTGGTGGTGTCGCCAGCCCCATCAACCCTTCCT
  TCGCAGACGATTGCTCCGCTCCCAGAAAGCACAGCCACCATCTTTATGCCCTTCCCAGTTCTGACTACCT
  CTCCCGAGGAGACCACTGACTCTTCCATCAATGGCACTGGGCACAGAAACCAAAGTTCCTCCTCTCCTGG
  CTGGACCTCCCCGGGGCTTCTGGTCTCTGTGCAATATGGACTCCTCCTGCTCAAGGCCCTGATGCTGTCA
  GTTTTCTGTGTGCTTCTTTGCTGGAGGAGTGGCCAGGGACGAGAGTACATGGCAGAGACGATGGAGCTTT
  CAAAACTACCTCACATCTCCAAGTCCTTGGACACGGTTAGCCACATCTCAGGGTATGAGAAGAAGGCTAA
  CTGGTACTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001033922
• Insert Size: 780 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001033922.2, NP_001029094.1
• RefSeq Size: 1730 bp
• RefSeq ORF: 780 bp
• Locus ID: 224840
• UniProt ID: Q3LRV9
• Cytogenetics: 17 C
• Gene Summary: Positively regulates Toll-like receptor signaling via TLR7, TLR9 and TLR13 in neutrophils and splenic macrophages (PubMed:25848864). Regulates TLR7 signaling by controlling ligand-induced recruitment of TLR7 from the endoplasmic reticulum to endosomes and lysosomes (PubMed:25848864). Positively regulates Toll-like receptor TLR9-induced production of inflammatory cytokines but is dispensable for IFNB1 production (PubMed:25848864). Involved in the anti-viral response to several viruses including influenza virus, vesicular stomatitis virus and cytomegalovirus (PubMed:25848864). Binds to late apoptotic, and necrotic cells, but not living or early apoptotic cells, but is not essential for uptake of dying cells by dendritic cells (DCs) (PubMed:22210914, PubMed:19155473, PubMed:25848864). Does not bind nucleic acids (PubMed:25848864). May participate in antigen presentation (PubMed:22210914).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) uses alternate in-frame splice junctions at the 5' ends of two exons compared to variant 3. The resulting isoform (1) has the same N- and C-termini but is shorter compared to isoform 3.