Rnd1 (NM_172612) Mouse Untagged Clone

CAT#: MC212716

Rnd1 (untagged) - Mouse Rho family GTPase 1 (Rnd1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rnd1
• Synonyms: A830014L09Rik; Arhs
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212716 representing NM_172612
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAGGAGAGACGGGCACCGCAGCCAGTGGTGGTCAGGTGTAAGCTCGTCCTGGTGGGAGACGTGCAGT
  GTGGGAAGACGGCGATGTTACAGGTGCTAGCGAAAGACTGCTATCCCGAGACCTATGTGCCTACCGTGTT
  TGAGAATTACACAGCCTGTTTGGAGACAGAGGAACAGAGAGTGGAGCTTAGTCTCTGGGACACCTCAGGT
  TCTCCTTACTATGACAATGTTCGTCCACTCTGCTACAGCGACTCAGATGCGGTATTGCTGTGCTTTGACA
  TCAGCCGTCCAGAGACCATGGACAGTGCACTCAAGAAGTGGAGAACAGAAATCCTAGACTACTGTCCCAG
  CACACGTGTTTTGCTTATTGGCTGCAAGACAGATCTTCGAACAGACCTGAGCACTCTAATGGAACTGTCC
  CACCAGAAGCAGGCACCCATCTCCTACGAGCAGGGCTGTGCGATAGCCAAGCAGTTGGGCGCAGAAATCT
  ACCTGGAGGGCTCGGCTTTCACTTCCGAGACAAGCATCCACAGCATTTTCCGGACAGCATCCATGGTGTG
  TCTGAACAAGTCTAGCCCAGTGCCCCCGAAGAGCCCCGTCCGAAGCCTTTCCAAGCGACTCCTCCACCTC
  CCCAGTCGCTCTGAACTCATCTCAACTACATTCAAGAAGGAAAAGGCCAAAAGCTGTTCCATCATGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_172612
• Insert Size: 699 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_172612.3, NP_766200.1
• RefSeq Size: 2203 bp
• RefSeq ORF: 699 bp
• Locus ID: 223881
• UniProt ID: Q8BLR7
• Cytogenetics: 15 F1
• Gene Summary: Lacks intrinsic GTPase activity. Has a low affinity for GDP, and constitutively binds GTP. Controls rearrangements of the actin cytoskeleton. Induces the Rac-dependent neuritic process formation in part by disruption of the cortical actin filaments. Causes the formation of many neuritic processes from the cell body with disruption of the cortical actin filaments (By similarity).[UniProtKB/Swiss-Prot Function]