Ttc5 (NM_177625) Mouse Untagged Clone
CAT#: MC212694
Ttc5 (untagged) - Mouse tetratricopeptide repeat domain 5 (Ttc5), transcript variant 2, (10ug)
"NM_177625" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Ttc5 |
Synonyms | 5930437N14; AW743060 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212694 representing NM_177625
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGGCTGATGAAGAGGAAGAAGCGAAGCACGTCTTGCAGAAATTGCAGGGACTGGTGGATCGGCTCT ACTGTTTTCGAGACAGTTACTTTGAGACACATAGTGTCGAAGATGCAGGACGGAAGCAGCAGGATGTACA GGAAGAGATGGAGAAGACCCTGCAGCAGATGGAGGAAGTACTCGGTTCTGCCCAGGTTGAGGCACAGGCT CTGATGCTGAAGGGGAAGGCACTGAATGTGACTCCTGATTATAGCCCTGAGGCCGAGGTGCTTCTCTCCA AGGCCGTGAAGCTGGAGCCTGAGCTGGTGGAAGCCTGGAACCAGCTGGGTGAGGTGTACTGGAAGAAAGG AGATGTCGCGTCTGCCCACACCTGCTTCTCAGGAGCCCTCACCCACTGCAAGAACAAAGTCTCTCTGCAG AACTTGTCCATGGTGCTCCGCCAGCTGCAGACCGACTCTGGAGATGAACATTCTCGCCACGTCATGGACA GCGTCCGGCAGGCTAAGTTGGCCGTGCAGATGGATGTCCTTGATGGCCGCTCCTGGTGTGAGTGTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_177625 |
Insert Size | 558 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_177625.4, NP_808293.1 |
RefSeq Size | 2405 bp |
RefSeq ORF | 558 bp |
Locus ID | 219022 |
Cytogenetics | 14 C1 |
Gene Summary | Adapter protein involved in p53/TP53 response that acts by regulating and mediating the assembly of multi-protein complexes. Required to facilitate the interaction between JMY and p300/EP300 and increase p53/TP53-dependent transcription and apoptosis. Prevents p53/TP53 degradation by MDM2.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks several exons, and its 3' terminal exon extends past a splice site that is used in variant 1. This results in a novel 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (b) has a shorter and distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218906 | Ttc5 (tGFP-tagged) - Mouse tetratricopeptide repeat domain 5 (Ttc5) transcript variant 2, (10ug) |
USD 530.00 |
|
MR218906 | Ttc5 (Myc-DDK-tagged) - Mouse tetratricopeptide repeat domain 5 (Ttc5), transcript variant 2 |
USD 330.00 |
|
MR218906L3 | Lenti ORF clone of Ttc5 (Myc-DDK-tagged) - Mouse tetratricopeptide repeat domain 5 (Ttc5), transcript variant 2 |
USD 630.00 |
|
MR218906L4 | Lenti ORF clone of Ttc5 (mGFP-tagged) - Mouse tetratricopeptide repeat domain 5 (Ttc5), transcript variant 2 |
USD 630.00 |
{0} Product Review(s)
Be the first one to submit a review