BC022687 (NM_145450) Mouse Untagged Clone

CAT#: MC212676

BC022687 (untagged) - Mouse cDNA sequence BC022687 (BC022687), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name BC022687 (NM_145450) Mouse Untagged Clone
Symbol BC022687
Synonyms AW050009; C130001I08Rik; Flj20080
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC212676 representing NM_145450
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAAGGCGGGCAGGAGGTGGGGAGAGAGTCAGTGAGTGACCTCGCAGAGGAGCCTGGAGAGGGGTCCC
CCCACCAGACAGCTAGAGGACAGAGTGGTGATGGTTTGGAACGGAGGCGGATCTGCTGCGACGGTCCCGT
GGTTCTGCCGGACACGAACGCTAACAGCTCCAGGCTGGATGAGGGTCTTCCCACCAGCTGTCCACACCCG
GGGGAGCTCAGCGGCGGGTGGGGAGAGTTCGAAGGCTTCCGGGAGTCTTCAGCTAAGTCGGAGCAGTTTT
CTCAGTCTTTTGAACTCCTGGGGAGAGCCACGGAATGTCAGCCGCTGAGAACCCCTTCAGTCCCCGAAGA
GGGCAGTTCTTGCCAGGTGCAGCAGGGTGGACCCTGGGTGACAGGAACTGCTGCTGGCCCATCTTCAGAG
TCCATTCCCAGCTATGAGAAGGTTTTTAGGCTTGCGTTTCAAGAAGTCGCCGTGGAACAGGCTCCTGAAG
ACGTTTGCTCCCTGGACCATTTCTTGGAAAGAAGCAATGAAGGGGCTGCATCTGTGCCGAGACTCTGTTC
TGAATCTAGGAAGCTCTGGAGAGCCCTGCAGAACACCGACACTGCGTCTGCTTCGAGGTGTCTCTGGGGC
GAATCTCACTGTCGGGAAAACCTCCTTCCTGTGCTTGGTGTAGACGCTGCTCAGAAGAGCCCCCCTGGAG
GCCAGGGTCATGTCCTGGAAGGTTCTGACTTGAGAAAACCTGAAGAGCTGCTGGCTGTCAGCGGTTTCCA
CCTGCACCACTGCAAAGCCCTGATTCAGACCAAGCTCTCAGGGACGTCCAGTAGCAGACAGGGCAGCCTG
ATTACCTACAGCCTGTTTCTGAAGACACCGCTCCAAGGGAACGGGCGCTACATCACCATTCCACAAAAAA
AGATCTTTACTCCACGCAACCTGAAAATGGCATTCTTTAATAATGATGTCTGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_145450
ORF Size 966 bp
Insert Size 966
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_145450.3, NP_663425
RefSeq Size 1915
RefSeq ORF 966
Locus ID 217887
Cytogenetics 12 F1|12 61.2 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.