Atxn7l3 (NM_001098837) Mouse Untagged Clone

CAT#: MC212664

Atxn7l3 (untagged) - Mouse ataxin 7-like 3 (Atxn7l3), transcript variant 2, (10ug)


  "NM_001098837" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Atxn7l3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Atxn7l3
Synonyms E030022H21Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212664 representing NM_001098837
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAATGGAGGAAATGTCTTTGTCTGGCCTGGATAACAGCAAACTAGAGGCCATCGCTCAGGAGATAT
ATGCTGACCTGGTCGAGGATTCTTGTTTGGGATTCTGCTTTGAAGTACACCGGGCTGTTAAGTGTGGCTA
CTTCTTCCTGGATGATACGGATCCTGACAGCATGAAGGATTTTGAGATCGTGGACCAGCCTGGGTTGGAC
ATCTTTGGACAGGTTTTCAACCAGTGGAAGAGCAAGGAGTGTGTTTGCCCCAATTGCAGCCGCAGTATTG
CTGCTTCCCGCTTTGCCCCCCACCTGGAGAAGTGCCTGGGAATGGGTCGCAACAGCAGCCGAATCGCCAA
CCGTCGGATTGCCAATAGCAACAATATGAACAAGTCTGAGAGTGACCAAGAAGACAACGATGACATCAAT
GACAATGACTGGTCCTATGGCTCAGAGAAGAAAGCCAAGAAGAGAAAATCAGACAAGAACCCTAATTCCC
CTCGAAGATCCAAGTCTCTAAAACACAAAAATGGGGAACTTAGCAACTCCGATCCTTTTAAGTATAGCAA
CTCAACTGGGATCAGCTATGAGACCCTGGGTCCAGAGGAGCTGCGGAGCCTGCTCACCACGCAATGTGGA
GTGATTTCTGAACATACCAAGAAGATGTGCACAAGGTCACTACGCTGCCCGCAGCACACGGATGAACAGA
GGCGAACCGTACGGATTTATTTCCTTGGGCCCTCGGCCGTTCTTCCAGAGGTAGAGAGCTCCTTGGATAA
CGATGGCTTTGACATGACTGATAGCCAGGCCCTCATCAGCCGGCTTCAGTGGGACGGCTCTTCTGATCTC
TCACCTTCTGATTCAGGCTCCTCCAAGACTAGTGAAAATCAGGGATGGGGTTTAGGTACCAACAGCTCTG
AATCACGGAAAACCAAGAAAAAGAAATCCCATCTGAGCTTGGTAGGGACTGCCTCTGGCCTGGGCTCCAA
CAAGAAGAAAAAGCCAAAGCCACCGGCTCCCCCAACGCCCAGCATCTATGATGACATCAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001098837
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001098837.1, NP_001092307.1
RefSeq Size 3702 bp
RefSeq ORF 1044 bp
Locus ID 217218
UniProt ID A2AWT3
Cytogenetics 11 D
Gene Summary Component of the transcription regulatory histone acetylation (HAT) complex SAGA, a multiprotein complex that activates transcription by remodeling chromatin and mediating histone acetylation and deubiquitination. Within the SAGA complex, participates in a subcomplex that specifically deubiquitinates both histones H2A and H2B. The SAGA complex is recruited to specific gene promoters by activators such as MYC, where it is required for transcription. Required for nuclear receptor-mediated transactivation. Within the complex, it is required to recruit USP22 and ENY2 into the SAGA complex. Regulates H2B monoubiquitination (H2Bub1) levels. Affects subcellular distribution of ENY2, USP22 and ATXN7L3B.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice junction compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.