Kctd11 (NM_153143) Mouse Untagged Clone

CAT#: MC212654

Kctd11 (untagged) - Mouse potassium channel tetramerisation domain containing 11 (Kctd11), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Kctd11
• Synonyms: AF465352; Ren
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212654 representing NM_153143
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTGGGGGCCATGTTTAGGGCTGACACCCTAATGCCAGCCAACCTTAACCCGCAAGGAGATGGCCATT
  ACTTCATCGACAGGGATGGCAAGGCTTTCCGGCACATCCTCAATTTTTTGCGGCTAGGCCGTCTGGACCT
  GCCCCGTGGGTACGGAGAAACTGCCCTTCTTAAGGCAGAGGCTGACTTCTACCAGATCCGGCCCCTCCTG
  GATGCCCTGCGGGAATTGGAAGCCTCTCGGGGTACACCTGCATCCACAGCCGCCCTACTCCATGCAGATG
  TAGATGTCAGCCCCCGCCAGGTGCACTTCTCCGCTCGAAGGGGCCCCCACCACTATGAGCTGAGCTCTGT
  CCAGGTGGACACCTTCCGAGCCAACCTCTTCTGCACTGACCCTGAGTGTCTGGCTGCCATGCGCAACAGA
  TTTGGTGTGGCCATTGGGGACAGGGCAGAAGGAGGTCCACATTTTCGGCTAGAGTGGGCCTCCCGCCCCC
  AGGAACTCCCTGAAGTAGAGTATCAAAGACTGGGGCTGCAGCCACTGTGGACTGGGGGGCCAGAAGATCG
  TCGGGAGGTAGCGAACACGCCTACATTCCTGGAGGAGGTGCTACGGGTGGCTCTGGAACATGGCTTCCGC
  CTGGACTCTGTCTTCCCAGACCCTGAAGACCTTCTGAACTCTAGATCCTTGCGCTTTGTGCGCCACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_153143
• Insert Size: 699 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_153143.4, NP_694783.1
• RefSeq Size: 2740 bp
• RefSeq ORF: 699 bp
• Locus ID: 216858
• UniProt ID: Q8K485
• Cytogenetics: 11 B3
• Gene Summary: Plays a role as a marker and a regulator of neuronal differentiation; Up-regulated by a variety of neurogenic signals, such as retinoic acid, epidermal growth factor/EGF and NGFB/nerve growth factor. Induces apoptosis, growth arrest and the expression of cyclin-dependent kinase inhibitor CDKN1B. Plays a role as a tumor repressor and inhibits cell growth and tumorigenicity of medulloblastoma (MDB). Acts as probable substrate-specific adapter for a BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex towards HDAC1. Functions as antagonist of the Hedgehog pathway on cell proliferation and differentiation by affecting the nuclear transfer of transcription factor GLI1, thus maintaining cerebellar granule cells in undifferentiated state, this effect probably occurs via HDAC1 down-regulation, keeping GLI1 acetylated and inactive. When knock-down, Hedgehog antagonism is impaired and proliferation of granule cells is sustained. Activates the caspase cascade.[UniProtKB/Swiss-Prot Function]