Rap1b (NM_024457) Mouse Untagged Clone

CAT#: MC212622

Rap1b (untagged) - Mouse RAS related protein 1b (Rap1b), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rap1b
• Synonyms: 2810443E11Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212622 representing NM_024457
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCGTGAATATAAGCTCGTCGTGCTTGGATCAGGAGGCGTTGGGAAGTCAGCCCTGACTGTACAGTTTG
  TTCAAGGAATTTTTGTTGAAAAATATGATCCTACGATAGAAGATTCTTATAGAAAGCAAGTTGAAGTAGA
  TGCACAGCAGTGTATGCTTGAAATCTTGGACACTGCAGGAACGGAGCAATTCACAGCCATGAGGGACCTG
  TACATGAAGAACGGACAAGGCTTCGCTCTGGTTTACTCCATCACAGCACAGTCGACATTTAACGACTTAC
  AAGATCTAAGAGAGCAGATTCTGCGGGTTAAAGACACTGATGATGTTCCAATGATTCTGGTTGGCAATAA
  ATGCGACTTGGAAGATGAAAGAGTTGTAGGAAAGGAACAAGGTCAGAACCTAGCAAGACAGTGGAACAAC
  TGTGCATTCTTAGAATCCTCTGCAAAGTCCAAAATAAATGTTAATGAGATCTTTTATGACCTAGTGCGGC
  AAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCCCGCAAAAAGTCATCGTGTCAGCTGCTTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_024457
• Insert Size: 555 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_024457.2, NP_077777.1
• RefSeq Size: 1937 bp
• RefSeq ORF: 555 bp
• Locus ID: 215449
• UniProt ID: Q99JI6
• Cytogenetics: 10 D2
• Gene Summary: GTP-binding protein that possesses intrinsic GTPase activity. Contributes to the polarizing activity of KRIT1 and CDH5 in the establishment and maintenance of correct endothelial cell polarity and vascular lumen. Required for the localization of phosphorylated PRKCZ, PARD3 and TIAM1 to the cell junction. Plays a role in the establishment of basal endothelial barrier function (By similarity).[UniProtKB/Swiss-Prot Function]