March11 (NM_177597) Mouse Untagged Clone

CAT#: MC212549

41344 (untagged) - Mouse membrane-associated ring finger (C3HC4) 11 (March11), (10ug)

USD 402.00


Availability*
5 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name March11 (NM_177597) Mouse Untagged Clone
Symbol March11
Synonyms 9630025C22
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC212549 representing NM_177597
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCGACGAGGGCAAAAAACGGTCTAGCCGGGCGGACAGCCTCGAAGCTGAGCCACCTCTGCCCCCGC
CGCCCCCACCCCCGCCTCCGGGAGAGTCGGTCCTGGTCCCCACCTCCCCACGCTACCGGCCGCCGCTGCC
CGCGCCTCTGGAGCGCATCGTAGGGTCGGGCGAGCCGCCGGTAGAACTGGCCCCTCGGCGCAAGGGCGCA
GGAGAGCCTCTACCGCCGCTGCCGCCGTCTCTGTTGCCCGGCGACCAGGAGGTGACAGCGGCGGGCGACT
CCTGCGAAGGTCCTAGGCGCCTTCCAGAGGTGAAGCTCCCCGAGGCTGCGACGGGGAAAGGCAGCCCGGG
GGAGCCCGAGGCCGGCGCGTGCCGGGAGGGCGAGCGGCGAGGCACCGGAGACCAGCCCGAAACACGCTCC
GTATGTAGCAGCCGCAGCAGCAGTAGTGGCGGCGGTAGCGACCAGCGCTCGGGGCACCAGCACCAGCACC
ATCAGCCCATTTGCAAGATCTGCTTCCAGGGCGCAGAGCAGGGTGAGTTGTTAAATCCTTGCCGATGTGA
TGGGTCTGTTCGATACACACATCAGCTGTGTCTTCTAAAGTGGATCAGTGAGAGAGGCTCCTGGACCTGC
GAGCTGTGCTGTTATAGATACCACGTCACAGCCATTAAAATGAAGCAACCTTGCCAGTGGCAGAGCATTT
CTATAACACTGGTTGAGAAAGTTCAGATGATCGCTGTAATCCTAGGATCCCTGTTCTTAATAGCGAGTGT
GACTTGGCTCCTCTGGTCAGCCTTCAGCCCCTATGCAGTGTGGCAGAGGAAGGACATCCTTTTTCAAATC
TGCTATGGAATGTATGGTTTTATGGATCTAGTGTGCATAGGCCTCATTGTGCATGAAGGAGCTGCCGTTT
ACAGAGTGTTTAAGCGATGGCGAGCTGTTAATTTGCACTGGGATGTGTTAAATTATGACAAAGCCACAGA
CATTGAAGAAAGCAGCCGAGGAGAGTCTTCCACAAGTAGGACTTTGTGGCTACCATTGTCAGCTCTGAGG
AACAGGAACTTGGTCCACCCAACGCAACTAACCTCACCACGGTTTCAGTGTGGCTATGTGCTATTACATC
TATTCAATCGGATGAGGGCCCATGAAGATGTATCGGAAGATAACGGCTCTGGGGAGGTAGTGATGAGAGT
GACGTCTGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_177597
ORF Size 1203 bp
Insert Size 1203
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_177597.6, NP_808265
RefSeq Size 1584
RefSeq ORF 1203
Locus ID 211147
Cytogenetics 15|15 B1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.