Havcr1 (NM_001166631) Mouse Untagged Clone

CAT#: MC212430

Havcr1 (untagged) - Mouse hepatitis A virus cellular receptor 1 (Havcr1), transcript variant 2, (10ug)


  "NM_001166631" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Recombinant Anti-Tim-1 (Clone 3B3)
    • 200 ug

USD 630.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Havcr1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Havcr1
Synonyms AI503787; KIM-1; TIM-1; Tim1; Timd1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC053400
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATCAGATTCAAGTCTTCATTTCAGGCCTCATACTGCTTCTCCCAGGCGCTGTGGATTCTTATGTGG
AAGTAAAGGGGGTGGTGGGTCACCCTGTCACACTTCCATGTACTTACTCAACATATCGTGGAATCACAAC
GACATGTTGGGGCCGAGGGCAATGCCCATCTTCTGCTTGTCAAAATACACTTATTTGGACCAATGGACAT
CGTGTCACCTATCAGAAGAGCAGTCGGTACAACTTAAAGGGGCATATTTCAGAAGGAGATGTGTCCTTGA
CGATAGAGAACTCTGTTGAGAGTGACAGTGGTCTGTATTGTTGTCGAGTGGAGATTCCTGGATGGTTTAA
TGATCAGAAAGTGACCTTTTCATTGCAAGTTAAACCAGAGATTCCCACACGTCCTCCAAGAAGACCCACA
ACTACAAGGCCCACAGCTACAGGAAGACCCACGGCTATTTCAACAAGATCCACACATGTACCAACATCAA
CCAGAGTCTCTACCTCCACTCCTCCAACATCTACACACACATGGACTCACAAACCAGACTGGAATGGCAC
TGTGACATCCTCAGGAGATACCTGGAGTAATCACACTGAAGCAATCCCTCCAGGGAAGCCGCAGAAAAAC
CCTACTAAGGGCTTCTATGTTGGCATCTGCATCGCAGCCCTGCTGCTACTGCTCCTTGTGAGCACCGTGG
CTATCACCAGGTACATACTTATGAAAAGGAAGTCAGCATCTCTAAGCGTGGTTGCCTTCCGTGTCTCTAA
GATTGAAGCTTTGCAGAACGCAGCGGTTGTGCATTCCCGAGCTGAAGACAACATCTACATTGTTGAAGAT
AGACCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001166631
Insert Size 849 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC053400, AAH53400
RefSeq Size 1893 bp
RefSeq ORF 849 bp
Locus ID 171283
UniProt ID Q5QNS5
Cytogenetics 11 B1.1
Gene Summary May play a role in T-helper cell development and the regulation of asthma and allergic diseases. Receptor for TIMD4. May play a role in kidney injury and repair (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Variants 2 and 3 both encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.