Havcr1 (NM_134248) Mouse Untagged Clone

CAT#: MC212429

Havcr1 (untagged) - Mouse hepatitis A virus cellular receptor 1 (Havcr1), transcript variant 1, (10ug)


  "NM_134248" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Recombinant Anti-Tim-1 (Clone 3B3)
    • 200 ug

USD 630.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Havcr1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Havcr1
Synonyms AI503787; KIM-1; TIM-1; Tim1; Timd1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212429 representing NM_134248
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATCAGATTCAAGTCTTCATTTCAGGCCTCATACTGCTTCTCCCAGGCGCTGTGGATTCTTATGTGG
AAGTAAAGGGGGTGGTGGGTCACCCTGTCACACTTCCATGTACTTACTCAACATATCGTGGAATCACAAC
GACATGTTGGGGCCGAGGGCAATGCCCATCTTCTGCTTGTCAAAATACACTTATTTGGACCAATGGACAT
CGTGTCACCTATCAGAAGAGCAGTCGGTACAACTTAAAGGGGCATATTTCAGAAGGAGATGTGTCCTTGA
CGATAGAGAACTCTGTTGAGAGTGACAGTGGTCTGTATTGTTGTCGAGTGGAGATTCCTGGATGGTTTAA
TGATCAGAAAGTGACCTTTTCATTGCAAGTTAAACCAGAGATTCCCACACGTCCTCCAAGAAGACCCACA
ACTACAAGGCCCACAGCTACAGGAAGACCCACGACTATTTCAACAAGATCCACACATGTACCAACATCAA
CCAGAGTCTCTACCTCCACTCCTCCAACATCTACACACACATGGACTCACAAACCAGAACCCACTACATT
TTGTCCCCATGAGACAACAGCTGAGGTGACAGGAATCCCATCCCATACTCCTACAGACTGGAATGGCACT
GTGACATCCTCAGGAGATACCTGGAGTAATCACACTGAAGCAATCCCTCCAGGGAAGCCGCAGAAAAACC
CTACTAAGGGCTTCTATGTTGGCATCTGCATCGCAGCCCTGCTGCTACTGCTCCTTGTGAGCACCGTGGC
TATCACCAGGTACATACTTATGAAAAGGAAGTCAGCATCTCTAAGCGTGGTTGCCTTCCGTGTCTCTAAG
ATTGAAGCTTTGCAGAACGCAGCGGTTGTGCATTCCCGAGCTGAAGACAACATCTACATTGTTGAAGATA
GACCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_134248
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_134248.2, NP_599009.2
RefSeq Size 1909 bp
RefSeq ORF 918 bp
Locus ID 171283
UniProt ID Q5QNS5
Cytogenetics 11 B1.1
Gene Summary May play a role in T-helper cell development and the regulation of asthma and allergic diseases. Receptor for TIMD4. May play a role in kidney injury and repair (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (a). The 5' UTR of this transcript has not been determined. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.