Vmn1r89 (NM_134226) Mouse Untagged Clone

CAT#: MC212409

Vmn1r89 (untagged) - Mouse vomeronasal 1 receptor 89 (Vmn1r89), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Vmn1r89 (NM_134226) Mouse Untagged Clone
Symbol Vmn1r89
Synonyms V1RE8; V1rj2
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC212409 representing NM_134226
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTTTCAAGTGACACATTCTTCCAGATCTTTCTCATATTCCAGTTTTGTCTTGGTGTGATAGGGAACT
CATCACTGTTAATGTTGTATGTATACACTTTCTTCTTCAAGCCTCATTTTAAAAAGTTGGTAGATTCAGT
TTTCATGCACCTGACAATAGTTAATATGTTGACAATCGCATTCACATTGATAAAAGATATCATGTTATCC
TTTGGAGTACCAAATTTTCTGGATGATATCGGTTGTAAGACAGTTTTGTTTTCATTCAGAGTCAGCCGGG
GTCTGTCCATCTGCACCACCTCTGTTCTAAGCACGTTCCAAGTCATCACCATCACTCCCAGTAACTCTAA
GTGGGCCTCCTGGCTCAAGCCTAGACTCTCTACATGGATTTTTTCTTCCTTACTTTGCTCCTGGCTTATT
AACCTAGTCATCTACGGGTATATGCTTGACATGGTAATAGCCAAAACCAATAAAACCCATGTTGGCAATG
GATATTCAGATGGTTACTGTCAAAACAAACACTTTGGGAACCACAATTCAGGGTCATTTTTTAGCCTTCT
CCTCACTCACGATCTCTTCTATGTGGCTGTCATGGTGTGGGCCAGTCTCTACATGGTGATTTTTCTCTAC
AGACACTACAAGAGATCCCAGCATCTCCACAGTAGAAGCCTTTCCTCCCAGTCATCTCCTGAGCGCAAAG
CCACTCATAACATCCTGTCTCTGGTGAGCTGCTTTGTGTTAATTTATTGCTTGAACAACTCCATCACCCT
TTATGGCTTTTATACAAAAGAAAAAATTCCAAGATTGGAGTCAATTAATGCAATTTTAACAACATGCTAC
CCAACTGTCTGTCCTTTTTTCCTCATGAAGAATAATAAAGTTATTTTGCAATTCACTTCTTCATTTTCGG
TACTGAGGATGACATGTCATCAAAGTTCACTGCATGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_134226
ORF Size 951 bp
Insert Size 951
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_134226.1, NP_598987
RefSeq Size 951
RefSeq ORF 951
Locus ID 171260
Cytogenetics 7|7 A1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.