Tirap (NM_001177847) Mouse Untagged Clone

CAT#: MC212298

Tirap (untagged) - Mouse toll-interleukin 1 receptor (TIR) domain-containing adaptor protein (Tirap), transcript variant 4, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tirap
• Synonyms: AA407980; C130027E04Rik; Mal; Tlr4ap; Wyatt
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212298 representing NM_001177847
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGTTAGTTTGGAGGCCTGCACTATGGCTTCATCCTCCTCCGTCCCAGCCTCCTCCACTCCGTCCAAGA
  AGCCTCGAGACAAGATAGCTGACTGGTTCAGGCAGGCTCTGTTGAAGAAGCCCAAGAAGATGCCGATCTC
  CCAGGAAAGCCACCTCTATGATGGTTCACAGACAGCCACACAGGATGGTCTCTCACCCTCGAGCTGCAGC
  TCACCCCCGAGTCACAGTTCACCGGAGAGCCGTAGCTCACCCTCGAGCTGCAGTTCAGGAATGTCACCTA
  CCTCGCCACCAACACACGTGGACAGCAGCAGCAGCAGCAGTGGCCGCTGGAGCAAAGACTACGATGTCTG
  CGTGTGCCACAGTGAGGAGGACTTGGAGGCGGCCCAGGAGCTGGTCTCCTACTTGGAGGGTAGCCAGGCC
  AGTCTACGCTGCTTCCTGCAGCTTCGGGATGCAGCCCCGGGTGGCGCCATTGTTTCGGAGCTATGCCAGG
  CACTGAGTCGTAGTCACTGCCGTGTGCTGCTCATCACTCCAGGCTTCCTTCGGGACCCCTGGTGCAAGTA
  CCAGATGCTGCAGGCCCTGACGGAGGCCCCGGCGTCGGAGGGTTGCACCATACCCCTGCTGTCCGGCCTG
  TCCAGAGCCGCCTATCCGCCGGAACTCCGATTCATGTACTATGTGGATGGCAGAGGCAAGGACGGAGGCT
  TTTACCAAGTCAAGGAGGCTGTTATACACTATCTGGAGACACTAAGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001177847
• Insert Size: 750 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001177847.1, NP_001171318.1
• RefSeq Size: 4677 bp
• RefSeq ORF: 750 bp
• Locus ID: 117149
• Cytogenetics: 9 A4
• Gene Summary: Adapter involved in the TLR2 and TLR4 signaling pathways in the innate immune response. Acts via IRAK2 and TRAF-6, leading to the activation of NF-kappa-B, MAPK1, MAPK3 and JNK, and resulting in cytokine secretion and the inflammatory response (By similarity). Positively regulates the production of TNF-alpha and interleukin-6 (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1-4 encode the same protein.