Pmch (NM_029971) Mouse Untagged Clone

CAT#: MC212225

Pmch (untagged) - Mouse pro-melanin-concentrating hormone (Pmch), (10ug)

USD 402.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Pmch (NM_029971) Mouse Untagged Clone
Symbol Pmch
Synonyms A230109K23Rik
Vector pCMV6-Entry
Sequence Data
>MC212225 representing NM_029971
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAAAGATGACTCTCTCTTCCTACATGTTAATGCTGGCTTTTTCTTTGTTTTCTCAAGGTATTTTAC
TTTCAGCTTCCAAGTCCATAAGGAATTTGGAAGATGACATAGTATTTAATACATTTCGAATGGGGAAAGC
CTTTCAGAAGGAAGATACTGCAGAAAGATCCGTTGTCGCCCCTTCTCTGGAACAATACAAAAACGACGAG
AGCGGTTTCATGAACGATGATGACAATAAGAATTCAAAGAACACAGGCTCCAAACAGAATCTTGTAACTC
ACGGGCTGCCACTGAGTCTGGCTGTAAAACCTTACCTCGCTCTGAAAGGATCCGTAGCCTTCCCAGCTGA
GAATGGAGTTCAGAATGCTGAGTCCACACAGGAAAAGAGAGAAATTGGGGATGAAGAAAACTCAGCTAAA
TTTCCCATAGGAAGGAGAGATTTTGACATGCTCAGGTGTATGCTGGGAAGAGTCTACCGACCATGTTGGC
AAGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_029971
ORF Size 498 bp
Insert Size 498
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_029971.2, NP_084247
RefSeq Size 748
RefSeq ORF 498
Locus ID 110312
Cytogenetics 10 C1|10 43.7 cM
Gene Summary This gene encodes a preproprotein that is cleaved to produce three mature peptides: melanin concentrating hormone, neuropeptide-glutamic acid-isoleucine (NEI), and neuropeptide-glycine-glutamic acid (NGE). The proprotein is processed differently depending on the tissue where it is expressed. Melanin concentrating hormone is involved in the regulation of food intake, energy homeostasis, and sleep-wake behavior. Disruption of this gene is associated with resistance to diet-induced obesity. [provided by RefSeq, May 2013].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.