Babam2 (NM_181282) Mouse Untagged Clone

CAT#: MC212154

Bre (untagged) - Mouse brain and reproductive organ-expressed protein (Bre), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Babam2
• Synonyms: 6030405P19Rik; AI429776; B830038C02Rik
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212154 representing NM_181282
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTTTGAGTACCAGACGCTCCTGGAAGAGCCTCAGTATGGAGAGAACATGGAAATTTATGCTGGAAAGA
  AAAACAACTGGACTGGTGAATTTTCAGCTCGTTTTCTATTGAAGTTACCAGTAGATTTCAGCAACATTCC
  CACATACCTTCTCAAGGATGTAAATGAAGACCCTGGAGAAGATGTGGCCCTTCTTTCTGTCAGTTTTGAG
  GATACTGAAGCTACCCAGGTGTACCCCAAGTTGTACTTGTCACCCCGAATTGAGCATGCACTCGGAGGCT
  CCTCTGCTCTTCACATCCCTGCTTTCCCCGGAGGAGGATGTCTCATTGATTATGTGCCTCAAGTGTGCCA
  CCTGCTCACCAACAAGGTACAGTATGTGATTCAAGGCTATCACAAAAGAAGAGAGTACATCGCAGCTTTC
  CTCAGTCACTTTGGCACAGGTGTCGTGGAATATGATGCAGAAGGCTTCACAAAACTTACTCTGCTGCTGA
  TGTGGAAAGACTTTTGTTTTCTTGTCCACATTGACCTGCCCCTGTTTTTCCCTCGAGATCAGCCTACGCT
  CACATTTCAGTCAGTCTATCACTTTACCAACAGTGGACAGCTTTACTCCCAAGCACAAAAAAACTACCCA
  TACAGCCCCAGATGGGATGGAAATGAAATGGCCAAGAGAGCAAAGGCTTATTTCAAAACCTTTGTCCCTC
  AGTTCCAGGAGGCCGCATTTGCCAATGGAAAGCTCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_181282
• Insert Size: 738 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_181282.1, NP_851799.1
• RefSeq Size: 1220 bp
• RefSeq ORF: 738 bp
• Locus ID: 107976
• UniProt ID: Q8K3W0
• Cytogenetics: 5 B1
• Gene Summary: Component of the BRCA1-A complex, a complex that specifically recognizes 'Lys-63'-linked ubiquitinated histones H2A and H2AX at DNA lesions sites, leading to target the BRCA1-BARD1 heterodimer to sites of DNA damage at double-strand breaks (DSBs). The BRCA1-A complex also possesses deubiquitinase activity that specifically removes 'Lys-63'-linked ubiquitin on histones H2A and H2AX. In the BRCA1-A complex, it acts as an adapter that bridges the interaction between BABAM1/NBA1 and the rest of the complex, thereby being required for the complex integrity and modulating the E3 ubiquitin ligase activity of the BRCA1-BARD1 heterodimer. Probably also plays a role as a component of the BRISC complex, a multiprotein complex that specifically cleaves 'Lys-63'-linked ubiquitin (By similarity). May regulate TNF-alpha signaling through its interactions with TNFRSF1A.[UniProtKB/Swiss-Prot Function]