Arl2bp (NM_024269) Mouse Untagged Clone
CAT#: MC212143
Arl2bp (untagged) - Mouse ADP-ribosylation factor-like 2 binding protein (Arl2bp), transcript variant 2, (10ug)
"NM_024269" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Arl2bp |
Synonyms | 1700010P10Rik; 1700027H16Rik; 6330544B05Rik; AI482273; AI849834; BART; Bart1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212143 representing NM_024269
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCGCTCCTCCGCCTCTGATGCAGAATTTGATGCTGTGGTTGGATGTTTAGAGGACATTATTATGGATG ATGAGTTCCAGTTATTGCAGAGAAACTTCATGGACAAGTACTACCAGGAATTTGAAGACACAGAAGAGAA TAAACTCACCTATACACCCATTTTTAATGAATATATCTCCCTGGTAGAGAAGTACATTGAAGAGCAGTTG CTGGAGCGTATCCCAGGCTTCAACATGGCGGCCTTCACAACCACGCTGCAGCACCACAAAGATGAGGTGG CTGGCGACATCTTTGACATGCTGCTCACATTCACGGATTTTCTGGCTTTCAAGGAGATGTTCCTGGACTA CAGAGCAGAAAAGGAAGGCCGAGGACTGGACTTAAGCAGCGGCTTGGTTGTGACTTCTCTGTGTAAGTCA TCTTCTACGCCAGCTTCCCAGAACAACCTGCGGCACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_024269 |
Insert Size | 459 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_024269.4, NP_077231.1 |
RefSeq Size | 1933 bp |
RefSeq ORF | 459 bp |
Locus ID | 107566 |
UniProt ID | Q9D385 |
Cytogenetics | 8 C5 |
Gene Summary | Together with ARL2, plays a role in the nuclear translocation, retention and transcriptional activity of STAT3. May play a role as an effector of ARL2 (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains an alternate exon in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at an alternate start codon compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG220657 | Arl2bp (tGFP-tagged) - Mouse ADP-ribosylation factor-like 2 binding protein (Arl2bp) transcript variant 2, (10ug) |
USD 365.00 |
|
MR220657 | Arl2bp (Myc-DDK-tagged) - Mouse ADP-ribosylation factor-like 2 binding protein (Arl2bp), transcript variant 2 |
USD 165.00 |
|
MR220657L3 | Lenti ORF clone of Arl2bp (Myc-DDK-tagged) - Mouse ADP-ribosylation factor-like 2 binding protein (Arl2bp), transcript variant 2 |
USD 465.00 |
|
MR220657L4 | Lenti ORF clone of Arl2bp (mGFP-tagged) - Mouse ADP-ribosylation factor-like 2 binding protein (Arl2bp), transcript variant 2 |
USD 465.00 |
{0} Product Review(s)
Be the first one to submit a review