Rab31 (NM_133685) Mouse Untagged Clone
CAT#: MC212128
Rab31 (untagged) - Mouse RAB31, member RAS oncogene family (Rab31), (10ug)
"NM_133685" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Rab31 |
Synonyms | 1700093E07Rik; AI415285; Rab22B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212128 representing NM_133685
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGGCGATACGGGAGCTCAAAGTGTGTCTTCTCGGGGACACGGGGGTTGGGAAATCCAGCATTGTGT GTCGTTTTGTCCAGGATCACTTTGACCACAACATCAGCCCCACTATTGGGGCATCTTTCATGACCAAAAC CGTGCCTTGTGGAAATGAACTTCACAAATTCCTCATCTGGGACACCGCTGGCCAGGAGCGGTTCCACTCC CTGGCTCCTATGTACTACCGAGGATCTGCTGCAGCCGTCATCGTCTATGACATCACTAAGCAGGATTCAT TTCATACCTTGAAAAAATGGGTCAAGGAGCTGAAGGAGCACGGCCCAGAAAACATTGTGATGGCGATTGC TGGGAACAAGTGTGACCTCTCTGATATTAGGGAGGTGCCCCTGAAGGACGCTAAGGAGTACGCTGAATCC ATAGGTGCCATCGTGGTGGAGACCAGCGCGAAGAATGCCATTAACATCGAGGAGCTCTTTCAAGGAATCA GCCGCCAGATCCCACCCTTGGGCCCTCAGGAAAATGGAAACAGCGGCGGGATCAAGCTTGGGAATCAGAG CTTGCAAGCCAGCCGTCGGTGCTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_133685 |
Insert Size | 588 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_133685.2, NP_598446.2 |
RefSeq Size | 3476 bp |
RefSeq ORF | 588 bp |
Locus ID | 106572 |
UniProt ID | Q921E2 |
Cytogenetics | 17 E1.1 |
Gene Summary | The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different set of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. Required for the integrity and for normal function of the Golgi apparatus and the trans-Golgi network. Plays a role in insulin-stimulated translocation of GLUT4 to the cell membrane. Plays a role in the maturation of phagosomes that engulf pathogens, such as S.aureus and Mycobacterium (By similarity). Plays a role in M6PR transport from the trans-Golgi network to endosomes. Plays a role in the internalization of EGFR from the cell membrane into endosomes.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218479 | Rab31 (tGFP-tagged) - Mouse RAB31 member RAS oncogene family (Rab31), (10ug) |
USD 500.00 |
|
MR218479 | Rab31 (Myc-DDK-tagged) - Mouse RAB31, member RAS oncogene family (Rab31) |
USD 300.00 |
|
MR218479L3 | Lenti ORF clone of Rab31 (Myc-DDK-tagged) - Mouse RAB31, member RAS oncogene family (Rab31) |
USD 600.00 |
|
MR218479L4 | Lenti ORF clone of Rab31 (mGFP-tagged) - Mouse RAB31, member RAS oncogene family (Rab31) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review