Nucks1 (NM_001145804) Mouse Untagged Clone

CAT#: MC212034

Nucks1 (untagged) - Mouse nuclear casein kinase and cyclin-dependent kinase substrate 1 (Nucks1), transcript variant 2, (10ug)

USD 402.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Nucks1 (NM_001145804) Mouse Untagged Clone
Symbol Nucks1
Synonyms 2700010L10Rik; 8430423A01Rik; AI647518; C78391; Nucks
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC212034 representing NM_001145804
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTCGGCCTGTCAGAAATAGGAAGGTTGTGGATTACTCTCAGTTTCAGGAATCAGATGATGCAGATG
AAGATTATGGAAGAGATTCAGGCCCTCCTGCTAAGAAGATTCGGTCATCTCCCCGAGAGGCTAAAAATAA
GAGGCGATCTGGAAAAAATTCACAAGAAGACAGTGAAGACTCAGAAGAAAAAGATGTGAAGACCAAGAAG
GATGATTCTCACTCGGCAGAAGACAGCGAAGATGAAAAAGATGATCATAAAAATGTACGCCAGCAACGAC
AGGCAGCATCTAAAGCAGCTTCTAAGCAGAGAGAGATGCTCTTGGAAGATGTTGGCAGCGAGGAAGAGCC
GGAAGAAGATGATGAGGCGCCATTCCAGGAGAATTCTGGCAGCGATGAAGATTTCCTAATGGAAGACGAC
GATGATAGTGATTATGGCAGTTCAAAAAAGAAAAACAAAAAGATGGTTAAGAAGTCCAAACCTGAGAGAA
AAGAAAAGAAAATGCCCAAACCCAGACTAAAGGCAACAGTGACGCCAAGTCCAGTGAAAGGCAAAGCGAA
AGTGGGTCGCCCCACAGCTTCGAAGAAATCAAAGGAAAAAACTCCTTCTCCCAAAGAAGAGGATGAGGAA
GCAGAAAGCCCTCCAGAAAAGAAGTCCGGAGACGAAGGGTCCGAGGATGAAGCCTCATCTGGGGAAGATT
AA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001145804
ORF Size 702 bp
Insert Size 702
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001145804.1, NP_001139276
RefSeq Size 6093
RefSeq ORF 702
Locus ID 98415
Cytogenetics 1|1 E4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.