Fstl3 (NM_031380) Mouse Untagged Clone

CAT#: MC211962

Fstl3 (untagged) - Mouse follistatin-like 3 (Fstl3), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fstl3
• Synonyms: E030038F23Rik; Flrg
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211962 representing NM_031380
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCGTTCTGGGGCACTGTGGCCGCTGCTTTGGGGAGCCCTGGTCTGGACAGTGGGATCCGTGGGCGCCG
  TGATGGGCTCCGAGGATTCTGTGCCCGGTGGCGTGTGCTGGCTCCAGCAGGGCAGAGAGGCCACCTGCAG
  TCTGGTGCTGAAGACTCGTGTCAGCCGGGAGGAGTGCTGTGCTTCCGGCAACATCAACACCGCCTGGTCC
  AACTTCACCCACCCAGGCAATAAAATCAGCCTGCTAGGGTTCCTGGGCCTCGTCCACTGCCTCCCCTGCA
  AAGATTCCTGCGACGGAGTGGAGTGCGGCCCCGGCAAGGCGTGCCGCATGCTGGGGGGCCGTCCACACTG
  CGAGTGCGTGCCCAACTGCGAGGGGCTTCCCGCGGGCTTCCAGGTCTGCGGCTCTGATGGCGCCACCTAC
  CGGGACGAATGCGAACTGCGCACCGCGCGCTGTCGCGGACACCCAGACTTGCGCGTCATGTACCGCGGCC
  GCTGTCAAAAGTCTTGCGCTCAGGTAGTGTGCCCGCGTCCCCAGTCGTGCCTTGTGGATCAGACCGGCAG
  CGCACACTGCGTGGTGTGTCGCGCTGCGCCCTGCCCAGTACCTTCCAACCCCGGCCAAGAACTCTGTGGC
  AACAACAACGTTACCTACATCTCGTCGTGTCACCTGCGCCAGGCCACTTGCTTCCTGGGCCGCTCCATTG
  GGGTTCGGCACCCAGGCATCTGCACAGGTGGCCCCAAAGTACCAGCAGAGGAGGAAGAGAACTTCGTGTG
  A
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_031380
• Insert Size: 771 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_031380.2, NP_113557.1
• RefSeq Size: 1953 bp
• RefSeq ORF: 771 bp
• Locus ID: 83554
• UniProt ID: Q9EQC7
• Cytogenetics: 10 C1
• Gene Summary: The secreted form is a binding and antagonizing protein for members of the TGF-beta family, such us activin, BMP2 and MSTN. Inhibits activin A-, activin B-, BMP2- and MSDT-induced cellular signaling; more effective on activin A than on activin B. Involved in bone formation; inhibits osteoclast differentiation. Involved in hematopoiesis; involved in differentiation of hemopoietic progenitor cells, increases hematopoietic cell adhesion to fibronectin and seems to contribute to the adhesion of hematopoietic precursor cells to the bone marrow stroma. The nuclear form is probably involved in transcriptional regulation via interaction with MLLT10 (By similarity).[UniProtKB/Swiss-Prot Function]