Lamtor2 (NM_031248) Mouse Untagged Clone

CAT#: MC211959

Lamtor2 (untagged) - Mouse late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (Lamtor2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Lamtor2
• Synonyms: 2010111E04Rik; AL022628; Mapbpip; P14; Rab25; Robld3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211959 representing NM_031248
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTGCGTCCCAAGGCTTTGACGCAGGTGCTAAGCCAAGCCAACACTGGAGGAGTCCAGAGCACCCTGC
  TGCTGAATAATGAGGGATCGCTGCTGGCCTACTCCGGTTATGGGGACACAGATGCCCGGGTCACTGCGGC
  CATCGCCAGTAACATCTGGGCCGCGTATGATAGGAACGGGAACCAAGCGTTTAATGAAGACAGTCTCAAA
  TTTATCCTGATGGACTGCATGGAGGGCCGTGTAGCCATTACGAGGGTGGCCAACCTTCTGCTATGTATGT
  ATGCCAAGGAGACCGTAGGCTTCGGAATGCTCAAGGCTAAGGCCCAGGCCCTGGTGCAGTACCTGGAGGA
  ACCCCTCACCCAAGTAGCAGCATCATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_031248
• Insert Size: 378 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_031248.3, NP_112538.1
• RefSeq Size: 586 bp
• RefSeq ORF: 378 bp
• Locus ID: 83409
• UniProt ID: Q9JHS3
• Cytogenetics: 3 F1
• Gene Summary: As part of the Ragulator complex it is involved in amino acid sensing and activation of mTORC1, a signaling complex promoting cell growth in response to growth factors, energy levels, and amino acids. Activated by amino acids through a mechanism involving the lysosomal V-ATPase, the Ragulator functions as a guanine nucleotide exchange factor activating the small GTPases Rag. Activated Ragulator and Rag GTPases function as a scaffold recruiting mTORC1 to lysosomes where it is in turn activated. Adapter protein that enhances the efficiency of the MAP kinase cascade facilitating the activation of MAPK2.[UniProtKB/Swiss-Prot Function]