Gatsl2 (NM_030719) Mouse Untagged Clone

CAT#: MC211937

Gatsl2 (untagged) - Mouse GATS protein-like 2 (Gatsl2), (10ug)


  "NM_030719" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Gatsl2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gatsl2
Synonyms 7530428J21Rik; AW742413; Gats; Gatsl1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211937 representing NM_030719
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAACTGCACATTCTGGAACACCGGCTGCAAGTTGCCAGCGTCGCCAAGGAGAGTATCCCGCTCTTCA
CCTACGGCCTCATCAAACTTGCCTTCCTGTCTTCCAAGACCAGGTGCAAGTTTTTCAGTCTGACCGAGAC
CCCTGAGGACTACACCATCATCGTAGATGAGGAGGGTTTCCTTGAGCTACCCTCCTCAGAGCACCTGAGT
GTGGCTGATGCCACCTGGCTGGCCCTGAACGTGGTGTCCGGTGGCGGCAGCTTCTCCAGCTCCCAGCCCA
TCGGTGTGACAAAGATTGCCAAGTCTGTCATTGCCCCACTCGCCGACCAGAACATCTCCGTGTTTATGCT
GTCCACCTATCAAACTGACTTCATCCTGGTGCGGGAGCGGGACCTGCCCTTCGTCACTCACACCTTGTCC
TCGGAGTTCACCATCCTACGCGTTGTCAATGGAGAAACGGTGGCGGCTGAGAATCTCAGCTTCACCAATG
GCTTTGTGAAGCCCAAGATGGTCCAGAGGCCAGTCATCCACCCACTGTCTAGCCCAAGCAACAGGTTCTG
TGTCACCAGCCTGGACCCTGACACACTGCCCGCCGTCGCCACCCTTCTCATGGATGTGATGTTCTACTCC
AATGGAGTGAAGGACCCCATGGCTGCCAGTGACGATTGTGGCCACATCCGCTTCTTCTCCTTCTCACTCA
TTGAGGGCTACATCTCACTGGTGATGGACGTACAGACCCAGCAGAGGTTCCCGAGTCACTTGCTATTCAC
GAGTGCATCTGGAGAGCTCTGGAAGATGGTGCGCATAGGAGGACAACCCTTGGGATTTGATGAATGTGGG
ATTGTAGCCCAGATCTCAGAGCCCTTGGCAGCTGCAGACATCCCAGCATATTACATCAGTACTTTCAAGT
TCGACCATGCATTGGTTCCAGAAGAGAATATCAGTGGGGTTATCCATGCCCTGAAGGTCAGTCAAGCAGG
GAAGCATTAG


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_030719
Insert Size 990 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_030719.3, NP_109644.2
RefSeq Size 4807 bp
RefSeq ORF 990 bp
Locus ID 80909
UniProt ID Q8CAB8
Cytogenetics 5 G2
Gene Summary Functions as a negative regulator of the TORC1 signaling pathway through the GATOR complex. As part of homodimers or heterodimers with CASTOR1, directly binds and inhibits the GATOR subcomplex GATOR2 and thereby mTORC1. Does not directly bind arginine, but binding of arginine to CASTOR1 disrupts the interaction of CASTOR2-containing heterodimers with GATOR2 which can in turn activate mTORC1 and the TORC1 signaling pathway.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.