Tnfrsf23 (NM_024290) Mouse Untagged Clone

CAT#: MC211913

Tnfrsf23 (untagged) - Mouse tumor necrosis factor receptor superfamily, member 23 (Tnfrsf23), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tnfrsf23
• Synonyms: mDcTr; mDcTRAILR1; mS; mSOB; SOB; Tnfr; Tnfrh1; Tnfrsf1al1; TNFRSFH23
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211913 representing NM_024290
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGTTACCTTCAGCCACGTCTCCAGTCTGAGTCACTGGTTCCTCTTGCTGCTGCTGCTGAATCTGTTCT
  TGCCGGTAATATTTGCTATGCCTGAATCATACTCCTTCAACTGTCCCGATGGTGAATACCAGTCTAATGA
  TGTCTGTTGCAAGACCTGTCCCTCAGGTACATTTGTCAAGGCGCCCTGCAAAATCCCCCATACTCAAGGA
  CAATGTGAGAAGTGTCACCCAGGAACATTCACAGGGAAAGATAATGGCCTGCATGATTGTGAACTTTGCT
  CCACCTGTGATAAAGACCAGAATATGGTGGCTGACTGTTCTGCCACCAGTGACCGGAAATGCGAGTGCCA
  AATAGGTCTTTACTACTATGACCCAAAATTTCCGGAATCATGCCGCCCATGTACCAAGTGTCCCCAAGGA
  ATCCCTGTCCTCCAGGAATGCAACTCCACAGCTAACACTGTGTGCAGTTCATCTGTTTCAAATCCCAGAA
  ACTGGCTGTTCCTACTGATGCTAATTGTCTTCTGTATCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_024290
• Insert Size: 531 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_024290.4, NP_077252.2
• RefSeq Size: 3305 bp
• RefSeq ORF: 531 bp
• Locus ID: 79201
• UniProt ID: Q9ER63
• Cytogenetics: 7 88.28 cM
• Gene Summary: This gene encodes a member of the tumor necrosis factor superfamily of proteins. The encoded receptor has been shown to bind to the ligand TRAIL (tumor necrosis factor-related apoptosis-inducing ligand), but to have no signaling capacity. This gene shows elevated expression in mice with diet-induced fatty liver disease. This gene and other family members are present in a gene cluster on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
  Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.