Prelid2 (NM_029942) Mouse Untagged Clone

CAT#: MC211828

Prelid2 (untagged) - Mouse PRELI domain containing 2 (Prelid2), (10ug)

USD 402.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Prelid2 (NM_029942) Mouse Untagged Clone
Symbol Prelid2
Synonyms 1700003A01Rik; C330008K14Rik
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC211828 representing NM_029942
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGGTCACCGTGGACGTGCACCAGGTGTTCCAGTACCCCTTCGAGCAGGTGGTCGCTTGCTTCCTCC
GAAAGTATCCCAATCCAATGGATAAAAATGTCATCTCTGTAAAAACTGTGGAAGAAAAGAAAGATGAATC
AACAGGACTCATCTATAGAAAGAGGATTGCTATCTGTCAGAATGTGGTTCCAGAGATTTTAAGAAAGGTG
AGTATTTTAAAGGTACCTGATATCCAGCTAGAAGAAGAGTCATGGCTCAGTCTTCAGAAAAGGAACATGG
CTATCCGGAGTCACTGCCTCACGTGGACACAGTATGCATCCATGAGGGAAGAGTCTGTCTTCCGGGAAAG
CGTAGAAAATCCAAATTGGACAGAGTTCATTCAAACAGGCCGAATTTCAATCACGGGGGCTGGGTTTCTC
AACTGTATTTTGGAAACTTTTGCTAGTACGTTCTTAAGACAAGGAGCCCAGAAGGGAATTAGAATAATGG
AGATGCTGCTAAAGGAACAGTGTGGCTCCCCCTTAGTGGAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_029942
ORF Size 534 bp
Insert Size 534
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_029942.1, NP_084218
RefSeq Size 724
RefSeq ORF 534
Locus ID 77619
Cytogenetics 18|18 B3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.