Calcoco2 (NM_001100177) Mouse Untagged Clone

CAT#: MC211781

Calcoco2 (untagged) - Mouse calcium binding and coiled-coil domain 2 (Calcoco2), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Calcoco2
• Synonyms: 2410154J16Rik; C77254; Ndp52; Ndp52l1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211781 representing NM_001100177
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACCAGTGCCCCATACCTACCTTGCTGGAACATGGCAACTTCTCTCAGGTCCTGTTTAACAATGTGG
  AGAAGTTCTATGCTCCTAGAGGAGATATCATGTGCTATTACACCCTCACTGAAAAGTTCATCCCTCGACG
  CAAGGACTGGATTGGCATCTTTAAAGTAGGGTGGAAGACCACTCAGGAGTATTATACCTTCATGTGGGCT
  CCCTTGCCAAAAGACCAAAACAAGGATTCAGCCACACAGCAGGAAATCCAATTCAAAGCTTATTACCTTC
  CCAAGGATGTGGAGCGCTACCAGTTCTGCTATGTGGATGAAGATGGTTTAGTCCGGGGAACAAGTGTCCC
  TTTCCAGTTTTGTCCAGACCCTGACGAGGACATAATGGTTGTTATCAATAAGGAAAAGGTAGAAGAGATG
  GAACAGCTCAGTGAGGAGCTTTACCAACAAAACCAGGAGCTGAAAGACAAGTACGCTGACCTCCATGAGC
  AGCTACAGAGGAAGCAGGTGGCACTGGAAGCAACACAGAGGGTCAATAAGACCTTAGAACACAAAGTGGA
  AGAGAAGGCCTCCTGGGAGAAAGAGAAGGCCTCCTGGGAGGAAGAGAAGGCCTCCTGGGAGGAAGAGAAG
  GCCTCCTGGGAGGAAGAGAAGGCCTCCTGGGAGAAAGAGAAGGCCTCCTGGGAGGAAGAGAAGGCCTCCT
  GGGAGAAAGAGAAGGCCCCCTGGGAGGTAGAGAAGGCCCCCTGGAAGGAAGTGAAGGCCTATTGGTGGAA
  TGATCTGCACCGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001100177
• Insert Size: 786 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001100177.1, NP_001093647.1
• RefSeq Size: 1409 bp
• RefSeq ORF: 786 bp
• Locus ID: 76815
• Cytogenetics: 11 59.4 cM
• Gene Summary: Xenophagy-specific receptor required for autophagy-mediated intracellular bacteria degradation (By similarity). Acts as an effector protein of galectin-sensed membrane damage that restricts the proliferation of infecting pathogens upon entry into the cytosol by targeting LGALS8-associated bacteria for autophagy (By similarity). Initially orchestrates bacteria targeting to autophagosomes and subsequently ensures pathogen degradation by regulating pathogen-containing autophagosome maturation (By similarity). Bacteria targeting to autophagosomes relies on its interaction with MAP1LC3A, MAP1LC3B and/or GABARAPL2, whereas regulation of pathogen-containing autophagosome maturation requires the interaction with MAP3LC3C (By similarity). May play a role in ruffle formation and actin cytoskeleton organization and seems to negatively regulate constitutive secretion (By similarity).[UniProtKB/Swiss-Prot Function]